Description :
From Genome Similarity Track
Location :
Scaffold_110:22518- 32170
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_110-snap-gene-0.28Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_110-fgenesh-gene-0.6Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_110-snap-gene-0.19Calmodulin-binding WW domain protein

Sequence
9652 bases(100 bases per row)
TACAGTGCGGTTACGTAACCTTTTAGCTTTTACAATAACCCAACCTCGTTTTGATACAAACGCTCGTTCTACATGGTGGGCGGCTTGAATGGGTGGTCTC
GTCCGCCAAAGCGGAGCTGCCCGGACTCCTTCTTGCCGCCGAGTCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCTTCTCGTGCGCAAACTCGACGAACGCGTAC
CCTTTCGACCGCTGCGTCGCGATATCGCGCACCAGCACCACGCGACAAAGCTTGCCATACTGCGCAAAATACTCTCGCAGCGTGTCTTCGGTCGTCTCGT
AGTTTAGGCGTCCGACAAAGAGCGTCACGTACGGGTTGCCCTGGATCTTCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTAGTGCGTGGCGAACCAGTGGCGCGGCTGAGACA
GTCGCGCGTGGTATTGACTTGATGGGTGCCGCTCGGCGGTGCGGTGGCGGTCCACAGCGCTTGGACGCGCACGGCGTTCGTCAGGGGGACTGCGACTGCG
ACTACGGAAGTGATGTCCCACTGTATCCGCTGGCTGCCCGCGCGCATCGCTGCCTTCGTCTGCATCCCTGCGGCGGCGCTTCCGGGATTTGCTACGCCCA
TCGGCATCTTCGTCTCGCGCCATTTTGCTTCTTTGCCTGAAAGAATCCAATTGAAATATGGATGAGAAGCGGTGATTGGCTATAAATACCAAGTGTATGT
TCTGACTGGCTAAAGTCGTAGGTTTCTCTTCACGCCTCTTCGATCCACCATTCCGCAATCTCCAAGCAAATCTTTACCCAAAGGCAACATGTCACCATGG
CGCATCAAGGAGCACAGCCTTCTTCGCTTCATTTCCACCGCAGCGCTAGTGATATGGACGTGCTCATTGTGGTCACAGCAGCACGTGCGCGGATTCCGCA
TTCTGAATTCCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCACGAGTGCGCCAGTGGCGGTGTTTGAGCCGTATGTGCATGGCCAGGTCGGGTACTA
TGGCGATCCGTCCAATCCCGACCCAGAGCGTGTGAATGAAGGATCCCCGTTCTCTCCAGATACTCCGCGCATCTACTTCAATGGGGAGCCAAAGCGTACG
TGCGTATGTTTGTGCGGTGTTGACGTTGAAGTTTAAGAGCGAGTCGTAATTTTGTGTGTGTGTGATGCTGGCTTAGAGAATTGCCCCGGGATGGTGGGTC
CGATCAACGATGCAGAATACTACTGTCGAGGACGCGAGTACGGCTACTGCGACCGACGTAACGGACTTTGCGTATGCAACCAAGGGTACACAGGCATGGA
CTGTACTGAGTGCAAGCCGTCGTACTTCAAGCGCGGCGGGATTTGCTACCCGAAAAGTACGTTATGTGATCCCTCCTTGAACACAGTCTGCGATCCAAGA
CAGACGACCCTATTTTATGCTACGTAGAGAGCTGCTTGCACGATTGCTCGCAGGGTGGAGAGTGCGACTACGCGACTGGGACATGCACATGCTTTCCCAA
TCGGAAAGGCGACGACTGCAGCCAGGTGTACTGCCAATTCGATCCGCTGTGCACGAGCTGCACGAGTTCAGCATGCCTCAGTTGTGCCGAGGGCCTTTTC
GTGGACCCTGTGACCCAGACTTGCGGTACGCACAGGCGATTTCTCACAATAGACCGAGCTGAATGCATTTTCTTTACGTTGATTACGTTGTTGTGCTATG
CTGTGTGGTAGTATCGTGCAAAAAGTACGACCCTCGGTGTCTCGTGTGCGATGCACGAGCGTGCCTCGTGTGTGCCGATCTGCTGCTCAACTCGATACGC
CGCAGTGGTGCACGGGCGACGCTCGACGCGCCGTTGCCCTTTGACGAGCTCCAGCGGGAGTTTTCGTTCAAGTTTTCCTACGGCAGCCAAGATCCGCGTG
TGTTTGACGAAGCCGAAGAGATTTTCCTGATCCCATCGTCGAGCCTTGCCCAAAAGTCATTGTTCCTGAACGAATCCAGTAAAACATGTGTCCAGGGCGC
GAATGCCGATGCATCGTGGTCGTGCACGCCCTATCGCGTCAGCCACCGCGTATGTGGCCACTCTGGGGTCGTCTCATTTGGCTCTCCGATCTATGCTATC
GCTGAGTCTGCGCAAAACATCACACTCACAGTGCGACGCAGTGGGGGTGGGCTCGGGAATGCGACCGTCGCGTACGAGATCCAGTACCTTACGGCGTCGA
TGGATGACGTATCGCCCACGGCGTACTACACGAGCTCACAGGTGTTATTTTTTGGCGAGGGCGTCGTTGAGCTCGCGTTCCAGCTCACAATCCACGACGA
CCATATTGTCGAGCCAAATGAAACTTTCCGCGTCGTTCTTCGCCAGTCGCTCGTGGATCGCAGTGTGAGCCTCGGCAACCAACGTTATGCTCTCGTCACG
ATCCTCGACGACGATGCAGCTCAATCGGACGCCAGCCTGACGTACGTGGTCGCACCAGCGGCTACAGTGAAGACCGGTGGACGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCCAGAGTGTTCTCGGAAGTGGCGCCGCAAAAAAGGTCGGAGGAGATACGTACATTATGGAATCGTACGCGGAAGA
CATCGAGGAGAACAACGATGTTATTGGTATGCCACTCTGGGAAGCGTACCGCACCAAGCAGGTTGGGCGCGTCGTGGACAATGTCGACGGAACGTATTCG
TGCACTTGGCAGCGGAAGCACGCGGGAATGTATACTGTGGCAGTATACTTGTTGAATCCTGGCGGTCTTCGTGGTGATTACTACGATGACGCATGGCTCG
AACTCGGTGCCGCGACTTCTGTCATCTCGCGTATCGACCGACACGTGAATTTTACGTGGGGAACAGGTCCGATCTTTCCTGGCGCGAGCGATTACGTAGC
TGTCCGCTGGAGTGGGCGATTGAAACCACGAGCATCAGGCGATACGATTTTCCATGTTGAAGCGGACGATCATGTACGACTGTGGGTTGACGATCTGCTT
CTGATCGACAAATGGGACGACACGTTCACGGGACAAGCGGGTGCGACGATCGCGTTAGATAGCTCGGTACTGTATGCGATTGTACTCGAGTACCGAGATC
TTGTTGGCAACGCCAGAGTGCACCTATCGTGGAGCAGCACGAGTTTTGCTAAAGAGATCATTCCAGCGTCCAATTTATTTTCAGCTCAGCATATCAGCGG
AAGTCCATTCTACAACGTGACCATACTTCCCACCTCAACCGCCAATGAAATGACCACCGTAATTCAAGGTTCCATGGCCACCATCGCTGGCGAGTTGTAC
TGCATCGAGATCTTTCCAATCGACATTTACGGGAATCCTCATCGTGTAGTGAACGCAACCAACGATGGAGTGGAAGCTCGACTGACTCTTACAACTGACA
AAAGCCTCGGTGGCATAGGCAGCAAGCAAAACGATGCGATAATTACGTGGGACACTAAGAAAGGGAGTCTTCAAGCAACATGGACGAACCTCTTACTGAG
TGGTATCTACAACCTTGACGTGTGGGTTAATGGCGCCAAAATCTACGGAAGCCCGTTTCAAGTGACAGTTGCACCCAGCGCAATGCACCCGACTCGATCA
GTGGTGACAGGCAACGGCTTGGCTTCCAACCGTGTCGCAGGCGTCGCGACGACACTCACGGTAGTAGCCCGTGACGCGTATAACAATCGAATTTACAGTG
GTGGCAAAAGTCCCGAGTTGGATATTCGTGCATTTCACACTACGACAACATCCGCAATTGAAGTTGGCACTGTCGTAGATAATGGAGATGGAACGTACAC
GCTGATTTACACACCGAGGATCGTCGGGAGCTACAACGTGCGTGTCATGCTGAATAATGCGCAGATCGGCAACAGCCCGTATTTGGTGAGCGTGGTACCC
AACGTTGCTATTGGATGGACGAGCACGGCGAGTGGCACGGGATTATCAGCGGCAGCGACAAACGTCCAAGTATCGTTTCAAGTAACGGCGCGTGATCTTC
ATGGTAACGATGTGAAGACTGGAGGAGCGACATTCCAAGTGATCCTAGAACTGGGTGTGAGAGGAAATGTGACCGGTGTGTGCACCGATTTACTCTCTGG
GATCTACTCGTGCACGTATACAGCCAAGTATGTTGGCTTGACCAAGTTGCACGTAATTCTCTCTCAAAGTGGGGCTACTATGGCCATTTCGGGCAGCCCT
TTTGCAGTTGATGTCGTGTCTGGACCTGCGCTCGGTTCGCGTTGCCTTGCTCAAGGCAATGGCCTTGTTGCGTCCGTCGCGGGGGTACGAGCGAATTTTT
CGGTGTCTATTCGAGATACTTTTGACAACGAAAAGCGGAATGCTGGCCAAGAGACAATCAATGTTGTCTTCAAGGGTCCAGCACCAGCCGCCACGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTGGGCTGATCATCTCATTTGTTGGTAATGACACATTTGCTGTGTCATATATACCGACTGTGAAAGGTT
CATATATGATCCAAGTTCAGGTAAATGGCGTCGATGTTCACGCGAGTCCGTTCTCAATGTATACATATCCAGCAGGACCGTGTCCAGCAACCACGACACT
CGATTTGTTGTCCCCAGTCGCTACGACGCTCATGCCGTTGGTGTACACGGCAGGATCGTTGATCACGTCGCGGCTCACGACGAGAGACGCCTTTGATAAT
GTACTGGAAACCGGTGGATACGCATTTCAGTTTGATGATGTGAGTCGAGTCCAGGAAACACCGCTGGTAGATGAAGCCAATGGAAGCTATTTCCTATCGC
TACGACCACGACAAAGCGGCGTGCTTCCGTTCCAACCAAAGATCTTGCTGCCTGATGGACTCAATGCAACGTATTTCTACAATCCAAATCTCGTGGGGCC
GTCCATTTTGAGGCGCAAGGACGCGACCATCGACTTTGATTATGGCGTGACACCACCCACGCAGACGGATGCAATGGAGACGTTCAGTGTCCGCTGGAAT
GGTTATTTACTGCCAAAATATAGTGAGATGTTCACGTTTGACGTCGATGTCCTTGGTGGAGTAAGTCTCTACGTGAACAACATGCCGTTGCTCGTGGGTA
TGTGGCCTGCCGCGAATCGTACTGAGTCGCTGTCAACACCATCTCGCATCTATTTGGTCGCGAACCAGTTCGTTTCGTTTGAAGTCAACTACACAAAGCC
AAGAAGCATGCCAAATGGACGAATACGGTTGTTTTGGAGGAGTTTGTCACAAAGCCACGAGGTCATTCCACCAAATCGGTTGTTTACATCGTGGAAGATC
ACGAACAACGTCCCAACGCTGCAGATTGTCCCCGCGAGCGCCCACCCGCCGTCCTTCACCGCCGAGTTCCCTAGTGCGACGTCATCTTCAGATGCCAATA
TTGCGAGAACATTTGTCAACGCAACAGCAGGAGAAACATTGTTCTTCCGTGTGACCGCTAGAGATCAACATAAGAACGTGCGACGCAATGGCGGTGATGT
GCTCCATGTTCTCTTCCCGCAGCTTCCACTGGACGTGACACCGTTTCCGGTTCGCATCACTGATTTGAATAACGCAACATATGAGATATCGTTTTCGCCG
ATCTTGAGTGGAATCTTTTCCCTGGTCATTGCTGCGACCTCACCGACGACAACGGGTTACAAGGGACTCAGTGTGGATGCGCTCGCAGTGTTCTTGCGTC
CGTATTATATCCATCAGAGCCCATTTACATTGAATGTCGAGCCAAACTCCGCCATGGCCGCAACGTCGACGATTACGGGCGACGGCTTTTACCAGGCAGT
AGCAGGTGAAGAAGCGAAGTTAACGATTCAGCTGCGCGATCTTCACTCAAATCCAACACAAGACAAGGCAAAAGCTGCAGGATCTACGTCACAGCTACCG
CGTTTACAGCTTCGCAGAATTGATGCTGCAGGTAGTACCGCTGCTGCAATCGTTGTTTCCGCAAAAGTGTCGGAGGCGGGCAATGGACGATACGAAGCAG
CCTACACGCCGATGCACACGGGGCTATACAAAGTACTGCTAAGCGTGGCAAATGAGAATACGTTCACATCCAAGAGCTCTAATCTGCGCGTGTACCCAAA
TATCGCGTCACCGCTCACGTCAACCATCTCGGGTGGCACTGGCCTTGGCCCTCAAATCCGCACCAAAACACTCGTCACGTATCGAGTGCTCCTGAACGAT
TTCTATAGCAATCCGATCGAAGCTCGCGGAAACAACCTCGTCGTCATACTTCGAGGACCAGAGATCGTATATCCTGAAGTCACTCAACTTTCCAGCAACG
AGTACGTCGTAGCGTATCAAGTGAGTTTACAAGGAGCGTACGAAATGCAGACTCATCTGGCAAATCACGATCACGGACTCATTGGGAACTACTTTGAGAC
AACGAGGTATGTGGGCAGCGCGGCTGTCCAGGTGATCGACCCAAACATTAACTTCGATTGGAGTGCGAACGAAACGATGCGGAGCTACCCACGCATTCAG
TGGAAAGGTTACATCAAACCATTGTACAGCGAGCAGTACACGCTGCAACTGGACGTGTTCCCCGCTGGGGCCGTCTACATTGATCAAAGTCCAGTGATCG
ACGCGTTTAATACTCCGTTAGCTCCGGGCGTGACGTCTGTCTCGGGGACAGCGAACTTGGTCGGCGGCAGACTGCATGCGATCACCATCGAGTATCGCAG
CCCATCGACCCGAGAGCTTTACGGATTCGTCGCATTGCGATGGCAAAGTGATCGCCAGCAACGCGAAATCGTACCATCCACAGCGTTCTTTCCCAGTGCA
CAAGAAATCAACCCAAGGTACACTGTCGTCGCAGTAGATTGAACTTGGCCACTGGTAGTAGATTGAATATCGCGGCTTCTTGTGCCTCACTCGTCATCGG
TTATGCAAACTGACGTCGAACTTAACCGGGACGCGACACCCTTTCACGTACCAATTATTCTGACTTGAGATGTGAACGAACGCCCGTCGCTGCTGATGCT
GATGATGCTGATGATGCGCAGGAAACGCAAGAACAGGGAAGAAGTCAGGCGGCGTTGAGGAGCAGTGCGCACGACACTATATAATCGGAAATGAGCGGAG
CAAATGCGAATGCGTCGAGCGTCACTCCGAATCAGTATGTGCAGCTTGCCGCAGAGCTGCGCACGTGCTTGGTGTTTGAGCCCAAGAAATGGCGCCATGT
GATGGAGAAATCGACCGCTGTGCTCAGCCAAAACGCTGCATCGGAGCGTCAGAGGAGCCATTTGACGCTTGCACGAACTGTCGATGGGCCGACCACGTTG
AAGAGGAAGCGACCACGAGTAACGACGAAGAGCACAAGTAATCGACCATCGTCGCGAGAGGAAGACGCCATGATACCGGGTCGCAAAGACGTTGCATTGC
CTACTTTGTCTCCGCCAAATCGATCCGCGCCTGTTGTCTCTCTTGCTGCGTATCTGAATCAACCTGCCATGGTGAAAGACATTCTAGAAGAAGAAGAAGA
TGCAGCGCTTCGTGATGAACATGTTGCCCATTGTGACAATGGCCTTGAGGATCCAAATCTCGGAGCATGGGAGGATGAGAATGAACTAGCAGGGAAAGCC
ATGCCTGCTCTCTCGCTGATTGAAGAAACAGAATTGAAAACCGGTCGGAGCTTCGTTACCAACACGTCGCGTCATCCTTCCATTGCGCCAGGGGGGTTAG
CAGTCGTTCGCTCTACCAAATCGTCTATCTCACCAGGGGTTGTGCTTCCGATCCTAGCTACGATGTCGCCACGAACCCGCCAAGGACTTGCACGACTGCC
TCCACCAAGCGAACATGATGTGAAAGAGATCGGTGAGCTGGAGTTTTTTGTTGAGTGTGCCAGTGAGAGCTTGTATCAGAATCTGAAGCGACAGCAGGTC
CTTCGCCAGAGAAGAGAGCTAAGAAACCCTGCAACGCGAGTGCTGCAGAGAAATAGGCGTTCACTTGATGAGCTGCTCGTATATCAAAAAGTTCTGATGG
CTCGACGCCAAAAAGTGAGCAGGAAACCGTCTCAAAAAGTGCCGCAGCACAAATGGGGTACGCGCGATGAGCAAATCTGCATGACTATGGAGGATGTAAA
CGTTGCCAATCTCGACATAGTCGTTTCTAGAGAGTCACCAGTTCTCAAAGACACAACTTCAAGAACAAGTTTTCCATCTCGAAATTACCAGCACCTGATG
CAGGAAAAAGAGAGTGCTTTGGAACACGAGCGCGATGCAAACATCAAAGTAGAACAGACCCTGACAGAAATCCAGCATTTTCTACCACTGGATGTCATTT
ACGCGTTCGGTATGGGAAAATTCGCGTCGCCAGCGCAACAGCACGCAACGCAAGTACTCTTTACTGTGGGCTCTCGCCTCAAGTTGAATTTGCTCATTCA
GGCTGTGCAGCAATGGAAACAAGTCGTCGCCGCGGCGAGGTTTCACGCAATGTCGGCAGCTTCACTACGGATTCAGTGTTGGTGGCGCCAGCTCTTGGCT
GTGCGAGAGCTACTCACCCGCCGACGGATACGAAGCGAGCTTCTTAAACGGCAGCAAGCTTTGCTGCGAATACTCGCAAGCAAGCAGCACAAAAGCGCGA
GCATCATTACGGATGCGATTCGACGATTTGCGCATCAAAACCAGCGACGGCGTCACAAAATACGCATGGAGGCAGCGCGGGTGATCCAGGAATTCTGGCG
AGAGCAGCAGGCGCTTTGGGCCGCGCTTCGGATTCAGCTGCGCAAGAAGCACCGTCTTGATGCCGCCGTGTGCATTCAAAAACACGTTCGTGGGCACCAA
GCGAGGGTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGGAGCTGAAGAAACAGCGCTTGGAGCGGCAAACGCGA
GAGCGAAAGCGTGAGATGAAGGTCCACGGAGCAGTAATTATGATCCAAAGAGCGTTCCGCAAGTGGCAGCGACGACGTATTTTATCACTTCGACGGCGAC
GTGCTCAATTTGAGAAGGACAAGCTGAAAATTCTGAAAGTGCAGTCCCATTTCCGTGGCCGAAAAGCTCGAAAGTTTTATATCCGGCATTTATTGGAGGT
ATTTCACGCTATTCCCGTGCTACAACGTGCATGGCGATGCTATCGAGCACGACAGATTCGCTCGGCGCTCGAGAGAGAACGTGGCAAACAGCGACAGCAA
TGGATCACGGAGATCAAAGAGCGCAGAAAAAAGCACGCAGCTCATCACCTGGTGCCTCAAGAAATGAAAAAGAAATGGAACCAGATCGTGGCAATAAAAG
ACAAAGTCGTCACGCAAAGCAGTAGCGGCGGCCATAATTCCAGTCCAAGTCCACGTGAAGTACAGGCTGCGACGAAGCTGCAGGCACGATGGAGAGGCAT
CAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATGTTATGAAAAGGCACGC