Description :
From Genome Similarity Track
Location :
Scaffold_658:22517- 24237
Sequence
1720 bases(100 bases per row)
cccccccccccaggTTGGGCGTGCTGTATGTGAAcaggttctgcagcagcccgttGCAGCCTGGCTTACTGGGGCTGAATTTGACGACAGAGACGAGCAT
CGTGTCTATTTTGCACGTTCAATATCAAACATTTCCATTGTGACAGGACCCGAGCTATAGCCTGTAGCCTATAGGTCCGGCAGTGCGACTACAACAGTGC
CACCACTCACAGTTCCGCCAGAACTCAGGCAGCCGCACTGAGCTACCGCAACAGAATACATAGTGTTGATAAGTAGATGATACCACACCATGCTACGACA
CAACGCAAGCGTTAGTGAGCAAATTATTCGCAGTGCGCGAGGAAAAAATGTTATGGCATGCTTCGCCACAGTacaggtcgtcgtcgcgaaATTACTGCGT
TTATTGGAGCGCTCGTTTCCAACTCTAGATATTATCTTGTATtgctagcagcagcgtttTCAGTAGCGCGCAACTCACACGACGCCATGAACACGGGCTG
ACGGTATCACCTTGCTACTGCGCTCTATTGACGTTATCGCCACAAAGGGTTTGTATTCATTGGTGGCGACAGGCCAACACGTACAGGTTTTTGTTTTTTC
GTCCAAAAGCTGCTCGTTGTTCGCTTTCAAACCTCATGCCGTTCAAGACGGTGATTTTGGCTTTGCTGCCCGTTTCATCACCGCCGTTAGCATGTTCTTG
CTTTTGATACGATTAAACTCAAGTCGTACTATGTGACCCAAAAGTCCACAAGACGTGCTGTACATTAGGCATGCAATCAGCGATTATGGCTCTAGTTAAA
CCTTGAAAAGGCGCCACATGCATACACCCTGGTCCCGCATTGTTATGCTCGCTAGAATTACGCTGTAATGCTACTCAGCGCTTTGCTGTGGGCACCATGG
GCATGCTGATCCAGAAGCATGCCTCCTACAGTAAATATGGTGGGGGCGTGGCGAAACTATACTATGGCGACATGTCGAGGAGCCGACAAGCCGAGGGAGG
TGTTGGACTTCCACGAACTCAAGATCGGCAACGAGCATGGTGGTGCAGTGTGGGTAGGGCGGCGCATACCGGACAAAAGCATAATTTTGGTTGCCATTTT
GTAAACTCGTAAACGTGTTTGCGTGGCCTGTAGTGAAGAACGTCGGGTAGGAGCACGATACCCAGAGCAGTTGTATCGGCGACTCAACTTGAGACTACCC
GACTAGCGCATGGCCTCGTGCAGTATGCGCGCCGTCGTTGATGAATTGGCTAAGTCCTGAAGAGAAACCAACCGTCGGAGGTAACTTGAAGCTCTCCTTA
GAAACGTCACGTAGCGCGCCACAACCCAATTATCGGGCAAGGCCAATTGCCAAGCGGATATTTTCCAATTCATGGATCTGCGTCGTGACTACGACGAAAG
CATGCGCTCGGCCTTGACCAAGGGTCCGGCTAAAGAGACATTCGGCGCTTCCGCTTGGTAGCGGACCTGCCCTAGCTGTATCACCAGCGGCCGATCTTCG
TGTTCCGCATACTATTCGCGTCCCTACTTTAGTGCCGCGTGATACATATGCAATACATTGCATAGCTTGGTACACACAGGCCGCTTCGCACAGCTCGGTA
ATCAGCTGGTTCTTATGTCTACCGGACGATGAATTTGAAATCCTAGTTGCTCTTCCGCTGGTCGTGCTCACATACGCTGCCTATTGTGATACTAACAATG
CCAGCATTTGTTTACATTGC