Description :
From Genome Similarity Track
Location :
Scaffold_315:22515- 28870
Transcript NameFunction/comments
Phyci_256947dynein heavy chain

Sequence
6355 bases(100 bases per row)
ACCTTGCACAGCTGACTCATCAGGAAGTACATCATGCTCGCCTCGTTTGCAACAGGCCGATAAACCTCACGCGCAAGATTGATCTCACGCTCCGCGTCTT
TGCCCTTCCGCAGCGCAATTCCGACGTCAATGGCGGTAAGCTTCGTCTTCTCAAGACCTTCAATCAGTGGAACGTCGGACAAGATGTCATCCGGAGCATT
CGAGAGGCGCTCAAGCAAGTCATTTTCAAGCTGCAGGAGTTGGATCTGGTAGCCGTTGAACTCCTGCTGAAGCTGACGCTTTTGCGTTTCCAAGTCGGGC
TGCTCCAAGTTCACAACGTTCGCAAGTAATTGATCTTCAAGCCCCTTCTCCGTTACGCTGAAGTCGATGAGCGTGCAGTACGCTAGTATCTCTGGCCGGT
AGTGCGGATTCGGCAACTTGGTGTGTAGATACAAACGGAAGCGCGGGTCCACTTCAATTTCCTCGGCCGCGAACTGCAGGAACCAATTGCGTCCTTTCTT
GTAAATCTGCCGCATGATGACAGGTTCCAAAGACGCGTCGATGGACTCGCCTAGGTTTTCAAGAATGACACTCTGCCCACTGGTGATAGCAGTTTTCAGT
GTAGTCGTCCAGTTCTTTTGCGCTGGTTGCAGGATTACCAGCGCTTGAGCAGCTGACTCCTGCTCTGCACGACCGTCAATCCCCTCCGGCTTCTTGTGTC
TGAAATCGCGAGCTCGTAGCCAAATGATTCCCTGTAGTTGCGGATCGACAAGAAGCGGCCAGCGCTGACATGCCGTGATGATGCATCCGTTTTCAATCGA
GATGCGATCAGCAGGCAACCCCTCGTTCATCCATTGGGCGACGTCGCTGCTGTCGCTGAGCACATCAAGTGGATCAACACCCACACTTTCGTGTGAGGGC
GACGGAGCAGACAGCGAGGAAGGCTCGAGGGACGTCTCAGTATCGACGACTAGTTCTCCACTCTCAATTGTGCCAGCTCCGTTGGGACCCCCGCTGTCGC
TCATATCGGGTGGGCTCGCAATCGTGATCGGGATTTCTCGGGTCACGATATCTGGTAGCCACGTGTTTTTCCAGAGCTGAGCTCGGAAACTTGCGTTGAA
CGCGCCAATATAACTCACAAATCCAGCAGCAAGCAGTGAGTCTCCAATGAGTGCGCTCTCGCCAGCTCGCAAAACATCGATCTCATGACTCCATCGTTCA
TTCTCAGAGGCCAAACCGTTAACCAATCGTTCAGCTAGTGATAATCGCTCTTGGCAAGCTTGCGCTTCAGCCTCAACCTTTGCCTTCTCATTCGTCGCAT
CCCGGAAAGAGTCCTGCAGCGCATTAAGCTGGCCTTCGACTTCTGCCACTAATTTTTGCACTGCAGCCAGCTCGCTATCCGCCTCCGCTTTTGTTTGGTG
TGCTTTTTCAAGTGTATCCATCAGCGGCTTCACCCGAACGAAAACCTGGTGAAACGAGATGATGTTGACAACCCACACACACAGGTTCGCGGCAGCCACA
GACTTGCTCTTCATCTTTTCGTAGTTGAAGTTCGGGTCCTCCTGTATGAGCGGTTCCACACGTGCCACAACTTCCGGAGGGATGTTTTCCTTATCGTATT
GCTCCAGTGACTGCTTGAACACATCCACCTTTGCCATCATCTTCTTGGCATTATCCCAGCTGAAGTTCTTGGTCTCCTTCTTGACCATCATGAGAACTGC
TGCTGTTACTTTCTCAACACCAGCCGGAGGCTTGCCCATTGACTTAAGCTCCGTCAGTGATGCTTTGTTGAGGCAGTTGACGGCTTGCTGCGCTGCATCC
AGCGCAGGTTTGGCGATTGCAAGCTCAACGGAAGCCTGCGCCTCGATTTGCGAAGCCACTTCTGCAGCCTGAGCAGCCTTAGCGCGCTCCTCGTCCGCCC
GACGCTGCTTAACCTCCGCATCTCCACGTTGCTTGCCCATTTGTTCCAGTAGCAAATCGGTGGCTTTCTTCCGTTCTTCCACCTTCTTCATCGTCAGCTT
CAACTCGTCTTGGAGCCCCGCAACATCGAGCGAAGTTTTCTTCAGCGTTGCCAACCCCACTTCTAGACGCTTGATTTTGAGCGTTTGTGATGAGCGCTTC
GCATCTAAAAGCGACCGATAGAAGCGAATGAGCTCTAAGAAAGATGTCGGCGTCACGTAGTTGTGTCGTCCATAGCTCTTAGCGTACATCGAGCACGCAT
TTGTGACGGATATGTGCATCTCTGCCATGTGATGGCATACGTTTTCCTGGATCGCTCGCGTTGAGAGCTCAACGTCTTGGAGGAAGTTCAGCGACACATC
TACGAGAGCTTCTTTCGGCCATGGATGGAACCAGTCCATGGTGCAGCAACTAATAAGAGAAGGGAAGTTCCTGCAACGAATGCGCAAATCTCCACCCACA
GGCGAGAAGGCTAAGATGAGATGCAGATTGGTACGCACTCGCTCGTAGAAGAACTCTTGGAGCTGATCTTTGGTATCTGGGACTCCACGGGCTTTCGCCT
CCATCCGTAAAGATCCAGCCATCGACTCAATCTCTTCGCTGGAAAACAGATCCGCAATGTATCCCGACGTCAACGCGTCCGTTAACGGTACCAGGAAACG
ATTGTCAGTGATCTGCGAGTCCGTAAGCAGCAGTACAATCGGTTTTGCCGGTCGGATACCAGCTTTGCGGTAAATGTCCTTCAGGTCTTCTTTAAGCTCA
CTCATCCCATACGAGGGAGAAGCACTGGTCGTCAGCGACACCAAAGTGTACCCGCAGATAAATGCTGCTAAGCGCGAAAGAGACTGTTTTCCAGAGCCAC
CGACGCCAATTAGGAGCGCATTTCCTCGAGGGTTCGCGAGAATGCGAACAATTCGAGTAACATGCTCCAGTGCTTGGTCAAACAACACAAGACTCATCAC
AGGATGCGTCTCGTTGTACTCAGCAAGCTTCCTCTCCATGCAAGCAGTGAGCTGAGTCTTTTCAACTACCGGGACGTAGCTATGCGTGCTGCCTCCATAT
TCACCTTCGATAGACGCCGATCCCGACGATGAAGCACCCAAGAAATTGACACAAATGAGGGGTGACGCGAAGATTTCCACTGGATCTTCTTCAAAGTTCT
TCTTTGTTTGCTCAATTGCCATCTCCGCAAATCTCTGAATCTCGCCTGGCGAGCTCATGCGATCACTAAAGACGCGGAAGCACTCGTGGATCCAAAGGCG
ACTAAACTGGAGAGAGTTGTTCAGATAAGCTTCCGGGCGGGCCATGAACATTCCTTGGACTAAGGAGCTCAGCTCGCGCATACTGAAAACGTAGTGAAAT
TTCGTCGCAGTAGGCAGGAAGTTCGCTCGCACCTCTGAATACAAGTCGATGGTTGCCGTGATAATAGAAGGAGCGAGTTTCTTGATCTTGTCTGCAAAAT
TTGTCAGATGCTGATTCAGTAGAGCTGAATAAATAGTGGTAAGATCCTGCTTCGACGGCATACTAACGCAGAGTGTGGAAAAGTGACGGTGGAGACGAGG
GTTAACGGTGAATGAGCCGGCCTTCTGATTCATGCACGCAAGGAATTGGACGTCTTGAATAAGTTTCTTCGACGACAGGTCATGTCGGTCGTACCACGAG
TTGTAATCCATGTACTGCCGCAGCAGCGCAAGCGCGGTCTGGGTACCAAACTCTTCGACAAACGGCATATTGAGATCGTCTAGGAAGTAAATGAGCTTGC
GATTGTAGAGCGGGCCATATACGCGTCCTGATCTTTTCTCGAGGTATTGCTCCAAACGAGACTGCAGCTCTCGAGCATCCATGTAATGATGCATGCTCAC
GTAGGCGAAGGCGATGTCATCCTCTAGCCCTTTCATGTGCTCGTGAACCAGCGATGACTTACCAGAACCGCTAGAGCCCACCAGAATCGTAGGGTTCCTT
TTTCGTAGGAGCAAGTCAATAATCGAGTGCACTCGCGTAGACTCCATGGTAGGAACCACAAGCACATGGAATGGAACGTCGCCTACAGGCATAAGTGTGG
GCACTTTTTCTCCCCAGTAGACGAGTTCGTTCCGCGTTACGTCGTAGTAGAAATCAAAGAGATTCGCCGTTCCACTAGCCAGCATTGCCGCGTTATTTGC
ATCCGCGCCGCCCGTAGCCGCTGGGAACGAACTAGATCCACCACTCGTTGAAGCCGAGGCAAACTTGTACTTGGCGACAGCCTTGAAGTGTGTCGAGAAC
ACCGCGCGGTCGTCCGTCCCCTTGTCACTTGCTAATGCGCCTCCGAACGCCCACAACCCACAGTAGATAAATGCATTCTCCAGCACTTCAGGGGTTTTAT
CGTGCTCGCTAATTAAGCTCAGCAATCCGTCCAACAAACGGCACTGCATCTCCACGATCGCGATCGAGACGACTGGAACAATCGTCTCAGCCTTCGTATC
CTCAAGCGCCAAAAACATCGAATCTACGTATTTCTGAAAGAGCCCGGGGAGGAATCCTGCCTCAGCACTGCTCTCACGTTGCTGTAACCAGGATTCAACG
GCAGGGTACCAGCCGATATGACCTTCATCTACGTAAATGATACCTGCGCGGGACACGGTGGCTGGTGTTGCGTTAACAAGGGAAGATATCTCGAATACCA
GTCGCATCGATTTCGTCAATGGAATGCGCTCGTTAGACACAAGCGTAAGAACCTTATTGTCATCCATCACAGTGTTCATGCTTTCAATCCACACAGCGTC
GATATCACCATCCAGGACAACCCATTTGTACGTCTGAGACTCACTATATGGTGTCACATTCTTCGACATGTTGCGCATGATAGACGATAGAACGCCATCT
TTCCAGTCGTTATCGAGGGTCATGTAGCCGTACAGCTCATCAGCTGTGATGGCCTTCGGGTTCACACTCTCAAACACAGTCAAATGCTTCGCCAATGCCT
TTCCGTCGTCATCAGCATTATGACAAGCGGCAAGTGTGTTCCAGATTGTGCTTTTACCGCAACCTGCAGGCCCGATCAGCATCACGCTGTGCCGCACCTT
GAGGACTTCTTCATACTCCATCATTTTCTTGAGGAATCCATCTTCCGGTTGAAGTTTCTTCTGCGCACAGACGCGAGCACACTTGATCTGTAAAGTGTCG
TTCTTCAAGTGAGGGAGCTCTTGATTCGGGAACAGATCTCGCAGCAAGCCCATGAACACCGGATAGTCAGGAGGGAGAAGCCGCGGGGTGTTAAAGTCTC
GAAGAACCTGCATAAGCACGGTCTCCTCGGACAGAGTTGAGTACGTACGACGCAGACTACCAGCGACAAGAAGCACTGATTTCACAGAGCGAAGTCCCCA
GTCGTAGTGTTTCTGCTTTGAGAGCAGCTCGCTGCTAAGATCGTAGAGTGTTACAAACTTGACGGAAAGCGCCCGCGCCTTCAGGAAGCCTTCTGCCATC
AGCATGTTCTCGCAGATTGGCTGCAAGTCTGGCTTGATCATCGCACACGAACGGAACAGTGCCTTCAAGTTCTCAGGTAGCTCCGCACGACCAGCATACC
CGGGGTTCATCGTGATAAAGAAACCCACTGTCGGCACCAGAGCGATAGTTTTGCCAAAGAATTCGCAATTTCCCGTCTTTGGCATTACTACAGGTTGTTG
TGTGCTACCTTCTCCTCCAGAAGAACCAACGTCGCTGCTAGCGCCGGCCGTTGGGGCACGATTTGTAGATGCTACCAGCAAAGTTGTCGCGTCTAGCACA
GTCTTCACCTGCGTTGCGACCACGGACAGGACTTCAACCGAGATTCGGTTGAATTCGTCGAAACATCCCCACGCACCCGTTTGAGCAAGTCCGCGGAATA
TGTTTGCCATCGTCAAGTAGTTCATCTGGTCACTGCAGTTGAAGACGTAGCACTGGAGTCCCATTCCACGCGCAAGGTCCTTCGTTGTTTCAGTTTTTCC
AGTACCCGCAGGCCCTGCTGGGGCTCCACCAAGACATAGCCGCAACGCTGTTGTTAGAGTGACGTAACAGCGGTCAGTTAGTGGAGTGATCACCAAGCGT
CCGCAGTTACCAGTGTACTCGTAGCTGTAAAACGAGCGGAAGTCGCAAATCTTGATGTGCACTTCCTTTTTCTGGCCTGTACTCGTTAGCACGGGTGTAG
TGTAGTAGCGAAGTTGTGACTGCCACTGGAAGTCAAGCGAACTCGATACTTTCTTCGTGATCAGAGATTGCACCACATCGCGTGCATGGACGTCGACAGT
AATGAGCGTGATAATCTTCTGTCGATTCAACGCTCCAAGTTGTCCCTGAACCAGCTTGATCAGCTCTTCAAGGCGCACTGTAGATACGTCGTAGTACTTC
TTGATGGCATCCTCAGTGCCATTTTCAAACTCTTCTAGCGCACTTTCCACCTCTT