Description :
From Genome Similarity Track
Location :
Scaffold_41:225127- 253100
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14754hypothetical protein
Phypa_INRA-310PPTG_14755GPI ethanolamine phosphate transferase
Phypa_INRA-310PPTG_14756hypothetical protein
Phypa_INRA-310PPTG_14757hypothetical protein
Phypa_INRA-310PPTG_14758phosphatidyl inositol kinase (PIK-G1)
Phypa_INRA-310PPTG_14759hypothetical protein
Phypa_INRA-310PPTG_14760hypothetical protein

Sequence
27973 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCCGCTTCAGATCCTCCACGCGCTGGCGCAGACGCCGCATCTCCGCGGCGTCCTCCCACCTGCGCCGATCCTCCATTCGAACGCGACGGCCCGGCGTCAC
TTGTTGACACGGTAGGGCATGCTCGCCATATCGTCGATCGTATTCTAAACCACGCTGATCCCCGCGCCCCGCCCACGGGCCGCGGCGCTCGACGCCGTGC
CAATCTGATCCCCTCACAGCGGCGCTACTTGGTGCGCTGGTTGGGCCCCATGCCGGATAGCTGGGAGCCTCGTGACGTCCTCCTCGCTGATGTTCCGGAC
TGCGTGGCGGCGTACGAGGCGGACCTCGCACCGGTGACGGATCGCGCTGAGGACGCGCCCGTCCGGCGCGCCTAGCCTCGTCCAAGGCTCGCTGATAACG
TCCGATCACGTCCCTCTCCACTTCAGTCACAGGCACCGCCTCCACTCTTCACGATCCGGTCGCGCGACACCAAGCTCGCGACAGTGCGGACACCCATCGT
CGTCGCTTCTTCGCCAGCTTCTGCCATCTCGGCTCCAAACGCCAAGTGTGGCGTGATCTCCATCTGAAGCGGGGGATGGTGTGACGGGCCGTTGTCACAC
AACAGCTACCGTGTCCACCACGGTAGTCAATCAACACGTAGAACAGAGTAAATGGCTAGCGCGGTCTCTCGTGTCGAGACCGTGTCGCTAACTATCAATC
TCAGAGTCATATTTGCCTGCTTCCTCGATCCTTCCAGTGTACGCTACAGTAACGGTACTTCAGTCCCGTTACAGCAACTGGCTTGGCGATTGGTGAATCA
CCTGTTACTGGCATGAAGGCAACCGGATTACCGCCACATCTAGCGGTTGCTAAGAAAATAAGTGAGCTACAAGAGCAACTATCTGAAGTCTGCGCAGAAA
TGGAAAAACTAAAACCAACTATGACAAATTCACTCCCAAACGAAGTAGCGGCGAAGGTAGTAAATGAAATGCGACAGCATTTTGTGGTTAACGGTGTGGC
TCCGGTATATTTGCGCGATATTGACATGAGGATTGACAGGCTGCGAGCCGACCTTGCGTCAGAGTTTCGTCACACTTTTAGTGAAGTCCAGCATAATAAC
GAAATCACTGTTCCCTCAACTACTAACACGGTGGAGGTTCCTGTGTGGAGATCGTGGAATTGGAGCAATGGCCAAATCGGTCATTCTGTTCCGATTGTAT
TTGAATTTCCCGCTAGGGCTAGTGTAAAGCTTATGTTCAATTTGTGGTATTTCGGCACAAAGACACTGGAATTCGCCCATATAGACTGCTCAGTAAGAAG
CACAATATCAAGCCGCAACATCATATGCGGCACTCGCGTGTTCGAGTAGTCATGGAACTCATTCAGAAGGTTGCTGAGGAGTCCTCCATGTTTCCAGCAG
GGGTCACGAAAATCTATGATCTTGACCTTCAAACAGCAGATAAGGCTTCTGTACCATCTTCGAGACGATGCTTGCAAAGTTGTACAGCGATACTCCTAAC
CGAGCCGAAGAGCTCTCATGCGGCACGATATATAATCAAGTATCGAAAGAAGAAGGATAATCAGTAACTTTGAATCAGATTTGTTTTGCTGAGTTGACCA
ATCAAGCCACGATTTCGACCTGTGATCTGCTTCTTATCACAAACACAGGCATTATTTACGTTTCTAACATGTCAAGAACGGTTTGTTTTAACAGACATTA
TTATTAAACATTCAAAATCGTTTTTTACAGCATGGTTTAGTAACGTTTTTCTTACATAGTGTACAAGTTTTCTAATCGACTCACTCCTGGTGAAGGTGGC
GACGGAAGACCCGGCTCGTACAGAAAGGCTCGAACATGTGCAGCAGCATCGCCCGCCTGCTCCTGCTGGGTGTGGCGTTCCATGCGCTATGCATCCTCAG
CGTTTTCGACATCTACTTCCAGTCGACTGTCGAGTCCTCCATTTACAGCGCCAACTACACCTCGTCGCCTCCAGCCAAGCGCGTCATCATCTTCACATTC
GACGGCTGTCGCGTCGACAAACTCTTCAAAGTCGTTGCCGGCAACGTAAACCACTACGACCTCAACCCGAACGGCTCTACAAACACCACCAACTTCAGCT
CCGACAGTCGTGTGCCTTTCCTAGGCGTTGTAATGCGAAATCGCGGCAGTTGGGGCGTCTCACACAACCACGCACCTACCGAAAGTCGGGCATGTCACGT
GGCGCTAACTGCCGGAATGTATGAGGACCCACACGCCGTCTCTAATAGCTGGAAGCGGCACCCAGTGCCCTTCGACTCCGTCTTCAATCAGAGCAATAAT
GCCTTCATCTTTGGTAATAAAGACGTCGCCCCGATCCTCGCAGCTCATGCACCACAAGCTGTGGAAAAGCACTATTCTGCGAGAGAGGAAGGCAACATGG
TACGCGAAGATACAACGCTGCTGGATCTGTGGGCATATCGCAGAGTGAAAGAATTATTTACAAAAGGAGCTGAAGCCAGGGATCCGGAATTGTACAGGAA
GTTGCATGACGAGAAATTGGTGATCTATTGTCATTTTCTAGGCACTGATTTGACAGGACCGAAATATGGTGCCGATTCGAAAAAGTACTTGGAGAATATT
GCTGTGGTGGATGATTTGATCGAGAAGACGTACAAGATGATCGAGGAGTATTATGGAAACGATGGACGAACAGCGTACGTCGTCAACGCGGACCATGGAA
TGGATCTTCGTGGCGACCACGGTGACGACGCTCCGGCCAAAACGAGGACGGCAATTATTGCGTGGGGTGCCGGTGTCCTGGGACCTGAGACAGCGAAAAA
GACTGACAAGCAAGATTTTGATATTGAGTTGCCCACTCGATCTAGAGTTGAATTGCAGACACGCCTGGGGGCACAGGCAAACGAGGAGGAGGTTGCTACC
CGTGAGTGGAGTGCAGTGCTTGACTTCAAGCGCAAAGATGTTATGCAGACAGATGTGGCGGCACTTATCAGTGCTTTGGCAGGACTGCCATATCCCCGCA
ATTCGGTTGGAGTTCTGCCGTTTACGTACTTGCCCAAGGACAAATATCGCGTAAATGCTATGCGTGCAAATGCACAGCAACTATACCACCATGCCTTACG
CAAGGAGGAAGTGAAGCGCGCTCACCGGGGGATGTTATTTGTTCCATACTCACCTCTCCACCATCGGGTACCAGACCTTGAGGCTCATATTGACGAGGCC
ATCAATAGCCTACCTGAAGGTAAAAGCCACGCAATTCACGACGATGCGCACCGTGTCGTGGAACTGTTGAGTCAGGAGATGATTGATATTTGTCGGAACG
CGATCGATTATTACCATACGTACGACTGGTTGTTCTTGCGAGGATCGATCGTGCTGGGGTACATTGGTTGGGCACTAATCATGACGGTAGCTTATCTGCA
CCCTCAAAAATTCCGCTTACGGTGTCTGTTGACTCCTATGATTGACGTCAAGTTTGCTGCTACTGTAGCTGCAGTGATGTGGTGGCGGTTTCTCGCAGAT
TCGCCGTCGACGTATTATCTTTACGGATTCTGCCCTCTTGTCTTTTGGAAATTCGTTTGGAGGCATCGTAATGACCTGCAAGCAGAACTCCCTTCTGTAA
AGAGTTTCGGTTGGAAATGGAGTGTTCCAGCTGCGTTGGTTGTCTGTTGCCTGGAGCTGGTTGTCGTTGGTTACAAGCATCGTGCCGCATTTAGCTTGCT
ATTTGTCCTGTTGGCATTGCAACTAAACGGAGACCTACAACAATCGAGAGGAAGCGTGCAACTGAAAGACCGTCTACACTATCGAAAATTGATGACACCA
CGTTTTTGTTGGTCTGCAAGCTGTCTTTTTATCGCCGTGTTCCCATGTCTGCCGACTGAGTATGGCGAAAACACATCGTTGGTCCATTTTGGAGCGTTGC
TGTTATTGCTTTGTACTTTTATTGTGGTTAGCAATATATCTCCTATTCACGATCAAAGATCCCAGTGGAAGTCGATGCTTTCTTCTGGGGAACCTCCAGT
GCTATTGGCAATGCTGACTCTGCAATGGACCTCAGCCTACCTGGACAGTAAAGCTGCACCTCCGCTTTTTATGGTGGCTTTAAACTGGATGCTTGTCATC
GTACCAGTGACATGGTTACTCGTTCAAACAAAGTACCAAAGCCCAGGGGCTGAGCTATCCTCGCTGAATTTTGAGAGTGAAGGCTATCTGGAGCGACAGC
ACACTGGTGAAGTCGCACACGTTGTGGTTGTGCGACTGATGAAAGTCATATTAGCGCTTGCGCCAGGCTTCATATTGCTTAGCACATCCTATGAAGTGTT
ATTTTACGTGGCACTATGCAGCGGGCTTGTCAGCTGGATTGTGGTGGAAGCAAAACAGATATCTACTCGAGGGGTTTCTATGAGTCGTGAAGTGCGGCGA
GCGCTGCTGCTGTTACTATTTGTCCAAGTTTCGTTTTTTGGTACTACCAACGTGGCGAGCCTTACAAGCTTTCAGATTCCATCGACTCGACGGTTCCTAA
CAAAATCCACTCCCTCCATTGCGCAAGCGCTAGTCGTACTGAAGCTCCTGATACCGTTCGTACTTGTCGCCTGTGCTTTCCGTCTGATCTTACTGCTACC
TTCGACAGTATCGACACAAGAAAAAGAGCTGCGCGGGAATTCTCTTTGGGTGTCGTCATATTTCCTTCTCGCAGTGGCTTTGGCGGACGTCCTCACCGTG
CAGTTCCTGTTTCTTGTAAATAATGAAGGCAGCTGGAAGCAGATGGGGAATTCTATCGCCGAGTTTTGCATCGTCAATAGCCAGATTGTCCTGTTGCCGA
CAATCAATTTTCTCGCTTGGGTTTTTGTTCACGACCTAGAAGCTACTGGCAGAGGATATGAGCTAGTAGAAATAAATGAAGACGAGAAGGATCACTAGAA
ACTTCATGTAATCAACATTTTTTTTATTTTGTTGTCATGATACTGCAGTCGCGAAGCCCCTTCATTTGCACGTAACAAGCTGCGACCAGGACAACTCGGA
TGCGCGGAGGGAGGCAACCAGCTCGACGTTTTCAAGTGCCAGTGAATATTCGCGTGCAACACGAGCTTTGGCATTGGCATGAACCACTTTGCAGTTTAGC
CCGTTCCCCCGAAGATGATACAGATGCACACGAGCACGCCCAAGTTTTAGCACTAGTAGGTTCCACGGATCGCTCAAGAACACCAGATTCATAAGCATCC
GCTGGGCTGTCGATGCCGAACTCGTACCAATTTCATCATTGGCTACATTGTTGTCAGTATTGTCCTGGCTTGTGCCTTGCTTTTTGTCGAGGTTACGTTG
ACTTATCCATGGAGTAACATTCAACATCGTGAGCAGAGGCCCCAGCAGATCATCATCCCAACTCACTGAAAGGCAACTGGGTTCCCACAAAGCACCCGCG
GCACTTGGAACGGCTGAGCGAGCAAAGAACAACGGATCAGGGACTGCATCACCTTTCTCCTGGGGTTTTACCTGACTGAAGTTCGTCGGTTTGACCCAAC
GACGTCGATGCCAGCGCATTAGTGCACGCACTGCTAAAATGACAACCACATAAATAATGGCAGCAAGAGCGACGGCCAGCATATCACTGTACACTCCTTC
AAGGTTCATTTTCCACGCATCCAACGTCTCGGAGCGCAGCAGCATGAAGGTAGGAACGGGTTCCACCTCATTAGCCTCCAAGATCCGGGCATCACGGTCG
TCGACGGCGATTCCTCCTTGAGCTACAAATGCAACGGCACCAAGAGCCAGTGTCGGAAGAAGATGGCCACGGACGCCAGAGACTCCGTGGGACGGAGTCC
ATGCCCCCGCCGAGGTCTGCAACAACGCTCGAAAACGGGCAAGTAACGCCATGAGCCAAACGCAGCGCATATGCACAGCTAGCCAACGCGTCAATGCTGC
GAAGCTGTCCGTTGTGCTCTCACCGCCGTCATCTTCCAGTTCGTACAGTATCAGCGCGTCGATAATGTGTGCACTTGCGTAGCAAAGCACGGGTAACCAA
CTGCCATACACCACGACCTGACTCGGAACAGCGAAGAAGACTCGAAGAGTACGTTTCAATCTTGACGTATCGGCGCTTGCAGCTGTGTCGAAGACTGAGC
CAACGGCGTAGCAAGCGACGAATAGACACACGACTCTCACGATGACGTACAACTGGCCAATATAGCGCAGAGTGGATGCCAGAGAGCTCCACTCCAGAGC
ATCAGTGTAGAGAATCTTGCCCTCGACACGCTCGTCAAATATGGTCGTCGTAGTGCAGACGTCGGGGTTGGTACAGTCTCGAATGCGATACAGCACCACA
ACGTTGTAAATCTTGTGTGCAAGCAGTACAGCCCCTCCCAGTCTTGTAAGCGGGTCCGATTCAGCTTCAATCAAAGTAATATCAAGTTTCTCGTTCTTGG
ACAGATTCTGCTGTAGTGCGGCAGTTCGCAATGACACAGTCTCCCATAGTGCGTCTCTCTCACTGCCATCAACAGTCAAGGACGCCGCCCATGGTTTCTC
ACAGAAGAGCGGTCGATCCAAGTCGTCCACACACAAATCCACTCCCGGATTGGCAGGGTCAAGATCGGCAAAAGTTGTGACCCAAACGCTGAGCCAATAT
TTATGATCCAGCAAGTTGCGTGACAAGAAACTCGTGCTGCTACTTGCCGCAGTGGAGCCGGAACTTGCACTACTTGTACCCGTCCAGCGAGCTTTGGCTC
GAGCTGCGAAGCAGACACGTTGTGGGAGCGAACTGAGTTCTCCTCGAGCCATGATCGCAATACCGTCGTCGGTCTGGGCCACATTCTTGTAGCTGGTAGT
GCTTGGAGCATTGGCTGCCAGGGCTTCAGCCAGAGTATCGAGCATACTAAACACCGTAGTCCCAGGTAGAGAATCTCCACAATCACTGCTGTATGCCGAG
TCGGTGGAGTGAGCACTTAAAATGCATGCAGGCCATGATGAATTTAGTTTTGGAGACGTTTCCAGTAGGTCTCGAGCCGTGCGTAGACCGTAAGAGCTTG
GAGTGAACTTATAGAGCGCCGTGGGGATCTCGGAAGAGATCAAAGACTCCCCGTCAGTAATGATCGAGCCGTTCCGGAAGATCGTGTGGCCTGGAAGTGC
CGTGGGGCCATAGACAGTAAAGACATTCGGCTCAATCTGGACGAACGGAAGACTATCGACACTTGAACCTGCACGCGGGACGTCGGAAACGAGCAGTGCG
TAGGCGAAGAGAGCGAAGAGGACGCGCAGAGCCGCGGATCGAGGCAGTCTGTCGACAAAAGCAGCCGTCTCACGCGTATTTTCCGGATGCATCACATTCA
GCAGCACCGCTGAGCGTTTGCGTTGCCAGTTAGCATCGGCGGTAACAGCGGACGAAGACGGCGCCCTCGCAGGACCTCCAGGTGCGGCTGCTTTCCCTCC
GTTTGCCTCGACTTCGTGTGATTCGCCCTGCACACGCTTGTTTGACTCGCGATGACTCTCGTCACCTGTGCTGGCCATGGTGAACACGAGCTAAAAGGTG
TCAAGTCCCCAATGGGGACTCCCCAACGGTTCGACCCGCCTGCCAGCGGTTTCGCCAGAACGCCCGTTCAGATAGGGAAGTCTCTGCTAGCAGAGTATAA
TAGCCATCGTCTCCATGAGTCCAAAACTTGTCACCAAGGTATACCCATCGATGAAAATCCATCAAGGCGTGTGACTTTACAGGAGCGGAGCCATGTGGAA
TAATGGGGTCGTGGGTTCAGCTAGGATTACGACACTTGATTGGAGGAATTGTTTGTGGGGTATCTCAGACTGTAATTTCACTTGACATTCCCCGACTTGC
CAGCTCGACTCGACCCGACTCCTTCTCTTGAGTCGTCGCCATGAGCATTGACTGGTCTCTCGAGTGCTGCAATGACAAGCAGTTCCTGTCCATCTTCCTC
ATCATCTGTTACGCCGTCGCCATCTTCAAACTGTATGAGGCGGAGACTTCTCATGCGAGTGCTGAATGGTCTACTAACTGCTTCACTCTCCTCTCTTTTC
TGCAGATGGCGCGTATCGATTCTTCACCCATTCAAAATTCTGTACGTCATCCTTTGCAATGCTGTCGCCGAATGGAAGAGAAATTGCACTAACGGGGTCT
TGCGACGTGCTGTGGCTGATGCAGAACGGTATTCCTGCACGAACTGGGGCACGCCACAGCTGCATGGCTCACCTGCGGCAGCGTACGACGCACTCCTTCA
TTATCACAAGTGCGACGCACTAGCTAATGATGCAATTGTTGCATGTCGACTCAGGTTAAGGGGATGGAGGTGCACCCTGACGAAGGTGGCGTGACCAAGA
CCGTCGGTGGACTCCAGTGGGTCATCCTTCCTGCTGTACGTTCCCGTTTCGAGCTCTGTAATACAGTGACGATGATATTGATACGGTTGTGTTCATGACT
GCAGGGATACTTGGGATCAGCTGTGTGGGGCATGGCGTTGACGATTGCGAGTGCCGATAAAACGGCGTCAGAGGTGGCAGCAGGCATCCTCATTTTCTTC
CTACTGGTCTTCATCTTCTACGCGCACAACGGCTACCTCCGCATCCTGAACTTCTGCTTCATCTTGCTGCTTGCGGGCCTATTGGCGCTGAACATTTGGA
CGACGTTCGACGCTCTCCAGTACGTGACGCTCTTCGTCGGTGTCATGAGCTGCCTCTTCTCGGTTTATGATATCTGGGATGACCTCATTTCCCGCCGCGT
AAACGAGAGTGACGCATCGTTCTTCGCCAAGATGACGCACACTTCGAGTCGCTGCTGGGGAGTGATCTGGGGTCTTATCGCACTTGTCTCGCTCGTCGCG
GCCGTGTATTTCAACCTGCTCGTTGCAGAGGACTCTGGTGAATCGCTCACCAACATCTCAGATGCCTCAGCAGGCACGAAGGTTGCACTGGCCTGTGCTG
TCGTCATTGTGGCTCTCGCTGTAGTGCACACAGGGTTCACACGGAGGTGCATGCTGCGGAAACGCGACGGATTCGGAAGCTACTTCGCCGCATAACCTTA
GATATGATGCTGACAATCACTACGGCAGTGTAGTCGCCCAACTGATAATTCTCCGGAAGAGTTTCATTCCTGTATCGTTATCACCCGAGAAGCCACAATT
CCACCTATACACCTACCTACCAAAACGCTACGGACTAAACAAAAAGCCCGCATCTTATAGTTCTAAGGACATTCCATTGTCCGCGAAAGGCTTACGATCT
TTTATTTCGCTTTGCGACTTGACTCTGGGAACCAACCACCTTATGAAAGAATACCGTTTGTCATGCGCTGGAAATTGTCATATTGACGCGTGCTGTAGTT
GCTGTTGCTCTTGCGGATGAGCGACAGTACGTGCGCCACAGTCTCTTGCTTGGATAGGGTCAGCTTGAAGCGGGAGCGTAGGCGCAATAAAATATAATCA
GCGTCGATGCCCAGGAAACACGGGTATGGTGACTGACGTGACATGACGTCCACAAGGTCACAGATCTCGTCACAGTGCTGTTGGCACGCAAGGAATCCTC
GTGTGCACAAGGTAACATACTCCTTGAAGCCCTCGGAGTCCTGGCCACCCATGGTCTCCACCATCTCGGCCGTCAGCTTGAATGGGGCTGTCTCGATGCT
CAGCATTCCACCAGGCGCGATACCAAGTAAGAAACCATAGTCGATATGGATAATGTGGCCTTCGTTGTCCAGCATGATGTTGCCGTTATGCCGATCCTTG
ATCTGCAGGAAGTAACACACGAGCGAGTATCCAGCCATAGACTGAATAAACTTCCGCTGCGCTGCCTTGAATCGGCGCGAGTCAGGTGGTCCATAGGATT
TCTCGAAGTGATGCAGCAGCGAAACGTAACCTTCACGTTTCTTCAGCCCATCCAGCGAAATTGCGTTGATCAGAGTCTCAATCAGTCCAGTTGACGAACT
CGTAGCGATGATGCGGTATCTCTTCACCCACATGGGCAGATTCGCTCCCCTGAATATTTCAACGAACTTCTGAATCAACTGCAGCGTAAATACCTCCTGA
CGAAGATCATCGTTACTCTTGCCAATCATGGACACGATGTCCCATCCGGGTAAGTGGCCGTACGGCGATGCAGCCATCAGCCTCGCTCGCTTTGAGCTCC
AGGACTCTCCGAAAGCTGCTTCAAAATCCCTGCGGCGAGCCTTCTCGCGCTCAATTGCTTCTGCGGTCAAGTTGCCCGATGCCAAGTCCATCTCCAGCGG
TGTCGAAGGTTGTCCCTCTACTATCACTCCGTCCACAGTCGTGTTATTTGCCGCTTTTTCGATAGGCTGCATGAGCACCGGTGGAGCCGTTGACGGCGTT
GACACAATGTCAGGGACGTCAATGGGGGTCTCAGGAACAGGGGCACGACGAGGCACGGCGACAGGAGTTTGGTACGGTTCAGGAGCAGGGGGAGGGATAA
TTGTTTCCGCTTGGACTTCCTCCGCGTCTTGAGCATCACCAGCAAAAGCTTCACTAGCCTGGTGCCCAATCAACTGACCAATTTCATCATCCTCGATGTA
GTTGACTTCCGAAGATTCAAGCGCACCGCTACCAGTTAGGTTCTGTCGTGATGGCGACCGTGGTGATTGCGGGAGTGAGGCATCGCACTGTTGTTCATCG
TCAAAAGGGTTGCCGCGAATCACCTCAAAAATCAGCAAAATAGGGACACGAGCTTTTGTCGAGAACGCGGTTCCTTCCTTCGTGGGTATCCGCACGATAC
GCTCAAAAGGGTCCGTGGCTTTCACCAGCGGCACATACGCCATAGGTGGCAGATGCAGTTTCTCTAAATACGACGGCAACTGGGCCTTCCGGTCCTGAAT
AGACGGCACAAAACGCAGCGCCTCAGCGATATCCGTGATCTGCTCCACGAAGTCACATTCGTCAGCAAAATGCTTTGCCAGCAGGGACTTGTCTGTCTGG
CTCAGGCGTCGCATAGACTCACTGAAAATACTGGTTGGTTGGTTATCAGTATCCTCCTCTTCAAGAATGGACAACCGCTCGTCTTGCTCGTAGTCGTCAC
CTGTAGGGTGCGTCAGCAACATGGAGTCAAGGTCTTCCTTTGGCGTGAGCAAATGCTGTTGAAAGCGCGAAAAGTCACGAAATCGGCTGTCCACGTCTCC
ATCTAGCGAGCCATTACGGTCCGATCCGTTCCTCGCCATAGGCGGTGAGATGGGTGAGTAAGAATCCATGCCTGCCGGCGAGCCACTTGCACCAGAGATA
CTGTGCGCTTGTCGACGGTGGATTGCAATCTCCTCTGTCAGCTTTACGATAACTTGCAACTGGTCATCTGTTGGCATCGGCAGATTACGCTTGTGCACCT
GCGACGCTTCGTGCTGGGGATCACGGCTGAGCACAGTGGCACGGTCTACACCTGCAACTTCACGCTCAATCTCCACCATCAACCGTACCACACGCGCGTA
TTTGTCCTGCATCTCCTTGGGTTTTCTTGGATCAAACGAGTCTTCGAGTGCGCCTTGAAGTTGCCATCGAAGAAGAAGCGCGAGGTGAATGGAGCGCGAA
CATACCGACAAAATGAGCTCATCCAGCCAGAAAATCTTCTCGAAGTCAAAATTCGGAATCGATAGATATGCATGAACGATCTGAGGCCAGTAGAACTCCA
CTTGGTTGATGCGCGTATACGAAAAGTGAAGCAGTTTCTCCACAATCGGTTTGAACAACAAAGGGTCACTATCGAGGTGACGATGCAGTAAAATCACAGC
TCGGTACACGCTAAAGCTACGTGCACGGAACTCGCGATGCAGACCCAAGATCTTCAGGTCTAGCGGGATTTCTGGATGGTCCATTGTGTGATCATAAAAG
CGTCGATCCTTCAGCAAGATCTCCTCGCATTCTTCTGCGGTAATCACCTTTGCCTTCAGCAGGTCGATAGCAATCTTCGCTGACTCAGTCTGTAGTGGTC
GCTTGGGCATAATCAGCTCAATCGGAGCCTCGGGATTCAATGGCTTTGGGTACAAGCAGATCCCCGCCTTTAGTCGCTCCACCATCGCCCGTAAGTAGTT
GATGTAATTCTGCGCCTCATAACAACGGTCACACACGCGCTTGGCGTAGTAGTGCGATCTCTGCGGGAGCGGGACCTTGTGCGTCGTAAACTTATCACAA
TACAGACCGTCACAACTGTTGCATTTGTATAGCAATGTCGCCGCAGCTGGCGATGGTTGTCCAGCCGCCGCAGCTTCTGCTGACAACCGAGTGCAATCGG
GACACTTGCACGTTACATCCGTCTCAGTAGACGGCACCGTCACAGTGCTCACTGGAGAGAGAGACACATCCAGCGATGCGTGCTGGAAGAACGCTGCTGC
TAGACGCGGTACTGTAGTCTCCACTGCTGTCTGGATCGCTCGGATCCACTTCTCCTTATCCATGGCTGTGTCGGCGTAGGCGTAGAAGACTTTGTTCTGC
GCGGTGGCAAACAGGAAGCCGTGCTGATAGATGTGCATGTTGCCTTTGCCATCCCATTCCTGCACTCCAAGTACGTCCACCTCACCCTTAAGTCGCAGCA
TATGATACGCATCCTCCTGTGTGCTGCTCGTACATTGAATAACACACAGGTTTAGCCTGTCATATCTATTTAATAGACTGGATACAATTCATCTTACCTG
TAATAGTGGAAAGATGTGCCCACGAGAAAACAGTAGCGTCGCAGCATCGGTGGCGGTGATGCTGGACTTGTGCGGAAGGTGAGATAGCCCTCGCAGCTGG
CGCGCGGGGCCTTCATGGCGCTCCAGGAGATCTGACGCGGTCTGTTGCGACGACGAAGTCTCGTTGTGGTGATTGGTTTCTGCGGACGCTCGCAATGGGG
AGCGCAAACCCAATCTACGCGTTGCCTGGCGCGGACTGGGGTGTGATGAGAGGCAGGCGATTACTCGTCTCCGACGGGGCCGATACGCGCGGACAGTAGC
TCGTCGGACAGAGGGGATGACGGGAGACACGACGAGGCTGGAGTGTCCGGACGCGCGTCGCTGAGAAGGGAGCTGCAGCGAGAGAGAGGAGCGGCCCGGA
GCGCGAGCCTTCTCTCTTCAAAGTGGGCGTTGCTGTGTTGTGTGTGGAGGCTCCCCCTATGTATGGCGAACCCGCGGGCCGGCTGATTGATGGCCCCGTG
GGTCTCTATGTCCCACGGGTTCTAAAAGACTGGTACAGAAGTGATACACATATTTTTGCTGGTTGCGAGCGCGTCAGTGTCAATAGCGATGGCTCGCGGG
AAGAAGACGGCAGCGCCGCTCAAGGCGTCCACGCCCAATGCCAATGGCGGCAACAAGGGCAACAAGAAGACGGCGGGTATTGCAGCGAAGAAGCAGAACA
AACAGCAGGTGCAGACGCCTGTCAAGAGCAACAAACAACCCGTGAAGGTCGTGAAGCAGCCTGTAAAGGAAGAGGGCGAAAATGAGGAGGAGGTCGACGA
TGAGGCTAGCGAGACGGAGGACAGCGATGAGGCTAGCGATAGTGACGAAGATGATGGCGAGGGCAGCGACGAGTTTGAAGATCAGGGGTCATCCTCCGAC
GATGACAGTGGTGACGAGGAGAGCGACGACGACGCTGAGCTCACTGAGCTTGAGAAGAAGACGCGTCGCTTCACGGTGGATCGCGAGAAAGAGATGCAAA
AGATGCGCGAGGATGGATCGCTTTCAGTGGCGTCGCAGCTACACGTGGACGATCTGTCGTCTGACGATGAAGAGAATGTCAACACCATTGGTAACGTACC
GCTCCGGTGGTACGAGGACTACGACCACATCGGTTACAATGTGGACGGCAAGAAGATCATGAAATCGAACAATGGTGACGGCATTGACGACGCTATCGCT
GCTAAGGATGACCCATACTATGAGTACGTCGACGTAGATGGTCACTATTAGGTTGAAGGAGGCTGACATTGTATTGCACTTTGTTGTTTGACAGCCGCAC
GGTGTACGACGCGTACAATGACCGCAAAATTGTCATTTCGGACCGCGACATGGAGATTATTCGTCGTATGCAGGCTGGTGCTTTCGCACACCCGGAGTTC
GAGGCCTACCCGGACTACGTTGACATTTACTCCTCGAACACAATCATCCACGCTATGGGTAACGACCTTGAGCCCAAGAGCCGATTCCTTCCTTCGAAAT
GGGAGCGCATGAAGGTTATGAAGATTATGAAGGGTATTAAGGAAGGTCGCATCAAACTAGACCAGGAACCCGAAAAGAAGCCCGAAGTCTACCAGATGTG
GTTTGACGACGACCAGGCGCAGACTCGCAAGGGTCCGGCCCACGTGCAGGCTCCGAAGATGCCGCTTCCTGGACACATTGAGTCCTACAACCCTCCGGAT
GAGTACTTGTTTACCAAGGAGGAGCGTCGCGCTTGGGAAGAAGCCGAACCGGAGGACCGTGACACGAACTTCATCCCAAAGAAGTTCAAGTCGCTGCGTG
AGGTGTGCGGCTACGGCGGCTTCGTGCGTGAGCGTTTTGAGCGCTGCCTGGATCTGTACTTGGCGCCTCGCGTTAACAAGCGCAAGCTTAACATTGACCC
GGAGTCGCTCGTGCCGGAGCTACCGAAGCCTCAGGATCTGCGTCCGTTTCCCAACACATTGGAGCTTGTGTTCAAGGGCCACACTGGCCGTATTCGTTCG
CTGGCTGTAGACCCGTACGGCCAGTACGTGGCCTCAGGTTCGGACGACTTCACTGTTCGTATTTGGGAGCTTGAGACTGCGCGTTGCCTGCATGTGTACA
ACGTTGGTGCTGTGGTGCACAAGCTGTCATGGAACCCGAACAAGGACCACCAGTTGCTGGCTGTGGCTGCTGCCAAGAAGGTCTTTATCATTGCTACCGG
AACAGGTAGCGCAGACCAGACGGAACTCACCAATGCGCTTGTGGGTGATGCCAGTGACAGCATTCAGACTTCCAATGATGATGATGGCAAGACAGATAGC
GCCAGTGGGGACGTCCAGGTCGTGGATGAGGATGAAGCCACTGTGGAGGCTGACGCGCTCAAGAAGAAGGTGCCGGTAACCTGGCGGTTCTACAGCGGCA
CCAAGGACAAGCACAAGTCAAAGAAGGCGGATCGGCCGTGGCTGGAGCGTCGTGTGGGCACTGGTATTCGTGTTGTGCTGCACCACACGAGCGACGTGAA
GGACGTGGCATGGCACTACAAGGGTGACTACCTTTCGACGGTTGCTCCTGGCGCTGGTGCCGGAGCAGTGCTGATTCACCAGCTCTCGAAGAGGAAGACT
CAGAACCCGTTCCAGAAGAGCGTGGGTCAGGTGCAGTGCGTGTTGTTCCACCCGTCCAAGCCATTCTTCTTCCACGCTACCCAGCGCCACGTGCGTGTGT
ACAACTTAGTGAAGCAGTCGATCGTCAAGAAGCTGTCTTCAGGTGTCAAGTGGATCTCGAGCATGGCGGTGCATCCGAACGGTGACCACTTGCTAGTAGG
AAGTTACGACCGGCGGTTGTGCTGGTTTGATCTGGATCTGTCTTCGAGGCCATTCAAGACACTCAAGTACCATGAGAAGGCTGTGCGCGACGTGTCGTTC
CACGCCAAGTACCCGCTCATGGCTTCAGCCTCGGACGACGGCACCATTCACATTTTCCACGCCATGGTCTACTCGTACGTATCGATGGCATTTTTTACTG
ACACGAAACGATTGAGTTCACTAACTGTGATGAACGTGTGACCTTTGCAGGGACCTGATGAAGAACCCGCTGATCGTGCCGCTCAAGATCCTGCGCGGCC
ATGAGGTCTCTGGTGGTCTCGGTGTCATGGCGCTAGCCTTCCACCCTGTCCTGGTACGTGTTTCATTTCATGTAGAGAATAATGCATCGTCCGTTCTAAC
TCCTGCTTTCAATTTTTCGTGTTTGCTTCGTAGCCATGGGTGGTTACAGGCGGTGCCGACGGCTCCATTCGCCTCTTCCAGAACATTCACTAACTCGCTC
ATTGTAGCGGGCTCGACGATCCGAGCAACCATCCGAGTGGTCGGCAAGGCAACGCTCCGTTTGTTGGAAACTTCAGTGCCTGTCGAAGCCAGCAACTCGT
AACTGTGACGATTCAATAATAGACAACGTGCATACGGATATCGGATCACACCGTTTCTGGCGGCTCCTTTAAAAGATACACATTCGTGGAAAATATAATT
GCGGCGACCATGGCGAACAGCAAATTGCTCGGCACATGATGACGGCATGGTAACGTGAAGCCTCGCCTTTCCGCGACCAACAAAAGCCAGTGCATTTTAC
CCATTTTGAGCCACGACACAACGCTAAACTCGCCAATTAATCCTAGCCAAGATGGCTGTGCGTACGTGTATCTGATGAGTACATGTAGTGACTATCACAC
CATACATGTACCTGTTGAATGGAGAGCACACCCGCATAAATGGACATGACAAGTCCTTAATTTATTTAGCAATGAAAAAAGAAAAGAGGAAGGTTAGGCT
ACAGCTAGAAAAGTCGGGAAGCTGTCGCTACTCGGTCCAAGCGGACGGATCCAGGTCTCCCCCGCCCTGCACATAACAGAATACACCTCGAGGCTTTACT
CGCAAAAAAGACCACAATACTTGAACCACCGCCCGCCCGCTTGTCCTTTTCCGATCTCCGCGAGTTCGCAAGC