Description :
From Genome Similarity Track
Location :
Scaffold_54:225100- 232262
Transcript NameFunction/comments
Phyin_T30-4PITG_17383Hsp70-like protein
Phyin_T30-4PITG_17384Putative uncharacterized protein

Sequence
7162 bases(100 bases per row)
ATCACTTAGCTTGCGACTCAAGAGCGCTAACGGATGTTCCACACCATCAATTACTTGGCTCAAAACCCCACATCAGATGCGTCCGTCATGACGAAGAATG
GCAGAGTGAACACGGGTAGATGCAGAACTGGAGAATTTTGCAGGAGAGCGCGGACACCATCAAAAGCTTGGATCTCCTCGGTGCCCCAACGCCAACCAGC
TGAAGTCTTGGCCAGTTCAGTCAGCGGATACACCAGCGCCGAGCACTGCGGGATGAATCGCCGGTAATAGCCGCAGAGCCCTAGGAAACGCTGCAGCTCT
TTCCGGTTGCGAGGAGGCTGCATAGTCCGGATAGCCTACGTCTTGGCTGGATCTAGGGTGATCGTTGATGATGAGATCTGATGGCCCAGGAAAACGATTG
ATCGTTGCGACCAACGGTACTTGTCCTTGCGCACATACAGCTTGGCCTACGAGTAACACCTCACGCAGATGGGTTACATGCTCCACCAGCGACGATTAAA
ATACGCAGATATCATCCAAATAAACCTCACAAATTCCTTGGAATTTGGGACGGCCAAGGAGGTGACGCATGAGTCGGGACCATGAATCCGGCATTCCGGC
GAGTCCCATCGGCGCGACGACCCATTGGTACAGCTCGCCGTTTGCCTGGAAGGCGATCCGTTCTCGTGCACGTGGCTCGAGCAGCATATGATGATAGCCA
GACATTAAATCGAGGGTCGAAAAGTACGCAGCACCACTTAACTTGTCAAAAATATCGTCTACACGGGGGATTGGAATCTTCGGGATGCCGCTTTGAGAAT
CGAGGTGCCTGTAGTCAATCACCCATCGGATGGATATGTTGGCATCACCGCTGCGAAGCCATTACGAGTGAGTTGGTGCTGCACCAGTCGCAACCGCCTT
CTTCGGAATTGCAAAAATGTTGGACACCCAGGCCGAGTTAGATTTTTCGATGTTGTTGTTGCCGAGCAATTCCTTGACAAACTTCGCCAGCTCTTGTTCT
TCAACGCGAGCGTGCAGGAATGACGAGCGTGATGATGGCGCAGCATCTGGCTTCAGCACGATGTCATGCTAGATTTCTCGCTCCGGAGGGAGCTTGCTCG
GCAACGACGATGGAAAAACGTCGTCAAACTCGTTCAGCAGTATAATAACGTCACGCGGTGTCGGCTTCGGTGCACCTGACTCTAGCACCAGCCGGAATAT
CTCGAAATACACATGGCTGGCCAAACGCTCCTTGAACGACTGAAGAGAGACTTCAAGTGGAGCCAAACACCTGGAGCTTTTGGACAGCACGGGAGTAGCT
TGATCTTCACCTCGTGTTGCTGGTGGTGAGTCGTTCGGGGACTCGTGACTTGAGCCGGGCCAGGTTAGCGACCGAGACGGCCAGTTGATTCTGGGATTGC
TGGCCTCCAGCCATGGGCGACCCAGTATACCATCGTACGCATATTCGAGGGTCCAGAAGGCAAACGGCACTTGCACTACTGACACACCGCAAGTCACTTC
CATATCAGAGATGGGTACGACACGCTGCTGAGCACGTCCATCGAAACCTCGAGCTACTAACATCGTCGTAGACATTGCGGACGTGTCGAAGCCTCGGCCC
AAGGCCAAGACACAATGGGAGGCGCCAGAATCAATCAACATCGAGCTGTCGCGGCCCGAAATACAAACAGTTTGCAGAAACGGATTCGAAGCGGACACAC
TGCGAGGTGTGACCGACATTTCCGTCGTCGAGAGGTCTGCCATCTCTACGATTGTGGTGTCCGTTTGGACTGTAGGAGATTGTGAACTGATGTTGCGCTC
GGTGGATACTCCACTTACATCCGCCGAGCTTGCTCGTTTCCCGGATATCCACCGCCCTGTGTAGACGTACGCCGAGGACACTGGCCAATGCGGTGTCCTG
TTCGCTTGCAGTAGAAGCACAGACCTTCGCGACGACACTGCTCCTTGCTGATGGAGCGCGTGGCCACAGCAGAGACGTCCATTGGCATCGGAGCATCACT
AGCTGAACGACCTCAAGAAATACGACGTGGCTCAGACGAAGAGTGGAAATGGGTACGCTCGAATGCTTGGGCGGCGGCAATGACTTCGGACAGCGTGCCA
CACCTCCGATACATGACTTCCTTACGGATTTCCGACTTGAGGTCATCGCAAAAGCGATCGACCTGGTCCATGGCGCTCATCTCACGAATCTGAGCCATGA
GTCGACGAAACTCGCGGACATAGTCCTCGACCGAGCCACGCTGGTGGCAAGCTTTAAGCTCGGCCCGTAGCCGAAATTGCTGATCGGATGGCACAAAATT
CTCACGTATAGCATCCGCGAGTGCGTCCACCATGGCGAAAGTGACATGGTCGATCACGACTCGGGCGTGATACCACGACGCTGCTGGTTGGAAGCAGCCA
CGTCGTCGATGCCCTTGCCCTCCATGAAGAGCTTAGCTCGAAAAAACACTCGTCGACCAATTTATCCGACTTCCCGCTGAAGATCGGCATGGACACTCCT
TCGAGGCGGTACGCACGAGCAAGTTGAGGAGATGGCACGACTTGCTGCAGCTGCTCCTGGTAGGCATGCAGCTGAGCCTGAAAATCTTGATGCATCTGCG
CGTTCTGCTGACTGAGACCGACAGCGATTCGGTCGATGGCTTGAACAAACAGCTCAAACGGGCTGAGCGGAGCCGTTCCAGCCGGCAAATGATCCACGTT
TCCGGATTCTTCCATGTTGGATCGTAGAGTGACGACGAGCAAGGGGTTCCAGAGGATTGAGGGCGAAGCGACGACAGCTGAAGACTTGACGAGGCGTTCC
CTTCCCCACAACGAAGAGAAGTGCTACCAATTGGAGTGAACCACTTGCTCAGACTGAGGCAAAATGCAGAATGAATTCAAACGGCCGGGCCTTTTAGCTC
CTACTGCTCTCTCCTACATGGACCTCCTTGACAGGTAAAGACACGCCAGTCCAGCCCGCGTGAGCGCGAGCTGTGTCGTAATCACATGCAGTGTCGTGGC
AGCTCTGGGAGGCTGCAAATGGTCTCGTCATCAGGCACTACTCCACGCAACTATGTTCTTCGGCTTGATTGGTGACATCTGAAGAGCAGACTGTTGATGA
TTGTAGATATCGCTGAGTTCTGCCACTGGATTAGCGCAGCCACTACAAAGAAGACCAGAGTGCATTAGTGCTTACATCGCCAGATAAACTGGTGGCTTGC
ACTCCCGAATATCGGCACTTAGATCTTCCTCGCAATGGCAACATTTACTAGCGCATGGTCGCATATATAGAAGCACAGCTGGGCTGCCTCAATTCCATAC
ATGTCGAGAACATCATCAAGAAGATCGATGATGGCATCAGCACTCATGTCCGTCTCGTTCTCGAGCGTCGCGAAGCGCAACAAGATATTTCCCCTTCTGT
GATGGCGATGATGGTCATGAAGTGGGTGTTGTCTTCAGTCCATGTGTCGATTGCAAAGCCAACTTTCTTTCCCGACAGCCGCCTCCTGACGGTCGATTGC
ACAGCGCCTTCGAGCGAAAACATGCTCTTCTTCAGCAGCTTCACGCTGCTGTGGTTGAGGTGCGTGTACGTACGCCTCTTTACCTTCTCGCACACGGTTA
GCCCCGGTTATCCATGATGACCCAGTCCAACCAGTGGTAGATGTTCCGCGAAAAACACCACCCTTCACAAATGCATCGAGACTTCCTTCACGCCGCTGAA
TGGTACGAAACTCGTCTTCGTGGGTGGCGGTGTGGCAGCGGGTAAAGTGCTCCACCAGGTCCGTGTAGCCTGCTTGTTTTCGGTGCAAGAAGCACAGGCG
GCACTGGTAGTAGTCGCCATCTTCTGGGTCAAAGAGAACGGCAGCGAGTGGCCTTAGGGGAACGGGGGGCATCGAAGCGGGGGGGGGTGTAGCTGAAATC
AAATTGAGCTGTGAGGCCTGGTGTGGACTCCAACAATCTTTAACGCAATGGACGGCGCTCGTCCGAGCAGTTTCCGACCACCAATTTATTAAGTCTGGTA
TCGAGCTTCATATTTATAGTTTTGTCTAATTGAGGATGAAAGTTCAATTACATTTTTTGTAGTATCTTTTTAAAATTATAATTACTGATATTATTCTTTG
CCTAGGGGCGAATGAGTGATGCTCAATTGAAAAGTGTGAGTAGCATGCTCATTGTGTCCCAAATCTGTTTGCTTTTTCAATTAGTATGCATTGGCTGCTC
TGTCTCTGAATGTTGCATGCTTTAGAGCAGATACTTTTCAAAGTAACCCAATAAACCCGCTCTTAGAAATCACTGGGTGGGTGGGTCGATTAATAAATAG
AATACCTTTACAAAATCGTAATATTTTTGCGAACACTGCTCGTAAACTGCTCACGTGTTTTTGAAAAAATAAAAATTAAATGCCTTTAAAAGCAGGGCAT
GGGAAATGTTTTTTTATTTTGCAATAAAAGTCGCTCGATTATAAAGATTGTAATATCAAACTTTCAATTATATCTAATTTAGAGCAACAAATCCAGTTAC
TATTGCAATTAAATAGAAAGATTCTTGTTTTTGTAAGTCGGTTAGATCAATGCTTTTAAAGGCTTCAATAATAATAATTCGAATACGCCTTTAAACAAAA
CAATAGTAATTCCGTAGATCTAATACCCATAATTGCGACTTTTTATAAAAAAAGTCCCACTAAAAGTGCTCATTGTTTTCGCTCTTTTTATAACTAATTT
TAATTTGATTTTAGCTTCTTACTTAAGAAGCAAAGTGCTCTTTAGAATTAAATCAAAACACTTTTGTTTTCAAAGCAAAGTGCTTTTCATTTTAAAATAT
AAAAACTTACTTTTTGTTTCCAATCGTGAAACCTCATATACGTAGGGGTTTTAAGGAGAACCAAAAACGTGGCAATGTCAAGCGGAGGCGTCAATGTCGG
CTCCTTATTACTGCTGCTTAGCGGCATCTTCGCTGTGTTCGCGGCACTGCTCGCTCGCCACGGATTCACAGGCCGAGACCATGGTGTGTAGTACATTTTA
CCATCACAACTCAGTTGTGACAACTGCAGCAAACCGCTAACCGTGGTACTTGGGGACAGTGGTGGGCATCGACCTGGGCACGACGTACTCGGTGGTAGCC
ATTTCGCAGAAGAACAACGTGACTGCAATTGCAGACAAGAACGGCCACGTATTGGTGCCGTCCACCGTCGCATTCCTACCCAGTGGAGGTTCGTACCAAG
GCTGCTTGTAAAGCAATCACCACTGACACCAATTCTGGTTGTTGCACAGCTGTCTTGGTCGGCCGAGAGGCACGAGCACACCGCACAACGGACCCTCAGC
ACACAATTTTCAACGCCAAGAGATTCATCGGTCAGAGGTTGGTTTGATGCAAAATAAAAATTGGCAAGAACTGGGAAGCTGACGGATGGATGCACTTTGT
GTCGGCAGCTACGAAGACGTTCTGACATCAGAGGCCGACGAGAATGGAGGTACGCCGTACGAGTTCAGTGTCAAAATGCTGCGAGACAACGAACACGACG
GCGTATGTTTCACGCTGGATCTACAAGACCATCCCAAGTGTGTGACCCCTGTAAATATTGGCACTGCAGTTGTGCAGCATCTCCGATCCATGGCTCATCA
GTTTGTGGGCCACGAGCAGATCACCAAAGCAGTCATCGCAGTGCCTGTGGACTTCAACAATAGACAACGAGACGCCACCGTGGCGGCATTCCGAGCAGCA
GGACTGGCAGTCTCTCGCGTGCTGGAAGAGCCGACGGCCGCTGCGATCGCCTACGGTCTGCACCAGGACCCGAATGTGAGCTTCATGCTGGTCTTTGACT
TTGGAGGAGGCACACTGGATGTGTCGCTGCTCTTCGCACGCAATGGCGCCATCAGTGTGCTGGATACGCTGGGAGACAATCACCTTGGCGGCGAAGACCT
GGACGCGCGACTGTCGGCTTGGCTTCTGAAGGAGTTTGAAGCTCATCTTGGGACGGCTATCACGTCTCGCGGGGCGGAAACTGAGACTAAGGCTACAAGC
GTCGATAACGACAGCAAGGAGCCGCCATGTACCGTGGCCGGTGTCCGTCAAGCGGCCGAATTGCTGAAAAGGCAACTGACTGATGCCTCCGTCGCTACAG
CTGCTTGCATCTGGAACGACGGTAAGAAGACGGTGCGAGTTGAAGTAAGAGCCACGCGGGTGCAGTTCGAAAAGCTCTGTGGCTCGTTGCTGGAGCGGAC
GATAATTCCTGTCCGTGAGGTTCTGGAGGCTAACAATATGGACACGGACGAGATCGACGCCGTTGTGCTGGTTGGAGGCTCCTCTCGAATCCCATGGGTG
CGTCAACGCCTCACTGACATGTTCGAGGGGCGCCCACCACTCTCAGACATTGACCCTGACCTCGCTGTGGCGTACGGAGCAGCGCGTACACTCGATTAGA
AGCAAAACCTGAAGAACCAATAGAAGACACGACCATTCATTGCAACAAATGACCACGATGACAGAGCCTAACTTGTCAGCTGTTTCTCCTCATCCATCAC
CTTAACTCTGAAACAACAGCTCTAGAGCGCCGTGACCGCCGTGCTCGCTGAGGGTAGTAAAGGTTCACACAACACAGGTTATTCGAGTACTCCAGCTCAC
CGACCTAGTTCCAAGACACTCCGTACCGATCTCAGCGAGCTCAGGCGATGAATACGCCGAGTAAAAGTCCTGAATGTAGTCAAGCGCAAACTTCTGCAGT
CGCTCGTTGATCCCGTCGTCGTCCTGGTCGGCGCGGTAGCCACGTTGGGTCGCGATGGCCTTGGTACACGTCACGAGCGAGAAAGATGCGCGCAAGTTCT
GCTTCTTGTTGAGCTCAATTGAGTGCGCATAGTGCTTACGCGCCTTCAGTAGGTTTTCCAGACCGCCGATCGTCGAGTAAACGTCACCCAGACGGCTGTG
CGAGATGGCGTCCATGGGGTTCAGCAGCACCAACTCCTCGTAGCAGAAGGCTGCGTAGCGATACGCGCCCATGGACAGGTACGTCTCACCCAGCTCCGTC
CACTGCAAGTAAAAGCACGTTGAACTGTGTTAAAACAGCTTTACGTAACCTGCACGCAGGAAATCGACGTACCGCCGCCTGGTCCGTGCCAAAGCTCCGC
AAAAACTCGTTGAGCGCTATGATCACGTCCGCTGCCTTCTTCTGAGCCTTGAGCACCGCGAT