Description :
From Genome Similarity Track
Location :
Scaffold_87:2251- 3665
Transcript NameFunction/comments
Physo_140554putative polyprotein

Sequence
1414 bases(100 bases per row)
GCCATGCAGAGCGACGAGTCGTCGGAGTGGGTGAAGGCAATGAATGCGGAGCTCAAGGCACACGCGGACAACGGATCATGGACGCTGGTCCGTCGGACAC
CGAGTGCTCGACCGATCGGTTGTCGCTGGGTGTTCGCAAAGAAACGCGACGAGCACGGCCGAGTCATCAGGTATAAGGCCCGCCTGGTGGCGAAAGGGTT
TAAGCAGAAGTATGGCGTGGACTTCTTCGAGACGTACTCGCCCGTGGCCAACATGAACTCGATCCGAGTGGTGTTGTCGGTTGTGGTGGCCGAGGCGTAC
ATCACCGAGCAGCTGGATGCGGACACCGCCTTTCTCAACAGCGGGCTGGTGGAGCGCGTCTACATGGAGATACCCTACGGAATCATCAACGCGAAGACCA
TGATGTGTCGGCTGCAGAAGGCAATCTATGGTCTGAAGCAGGCGGCAAATGCCTGGCATAAGACCATCCACCGAGCCTTCGTGGGCATCGGATTTCGGAG
CTGCGGCGGTGACCAGTGTGTATACGTCAAGGGCGAGAAGGGCAGGTTCGTGTACGTCTGCCTGTACGTGGACGATATGATCATCGCAGCCAAGACGAGC
AGCGAGATCCAGGAAGTCAAGGTGGCGCTCAAGAATGCGTTTAAGATGAAGGAGTTGGGCGAGGCCAAGTTCATTCTCGGTATGGAGATCGACCATGACT
CATCGGCGAAGACTCTCATGATCAAGCAGACTCGATGCATTGATGATGTGGTGAAGCGGTTCAACCAGCAGGACGCCAAGGTGGTGGTGAACCCGTGCGA
GTCGGGCATGAAGTTGTCGAAGACTCAGTCGCCGATGACTCAGAAGGAACGTGAGGAAATGCAGGCGAAGCCCTACCGAGCACTCATTGGCTGTTTGCTG
TACATTACAACGTGCACCAGACCTGATGTGGCGTACATCGTGACCCAGTTGTCGCGCTTCCTCGAGAACCCCGGGCAGCAGCACTGGAAGGCTGCCATCC
GCGTGCTCAGCTACCTGAAGAGCACCCGAGACATCGGCATCGCCTACAATGGGAACGCGAAGAAGGTCGAGGTGACAGCGTACACCGACGCCGACTGGGG
CAGCAATCTCGACGACCGACGCTCGGTGTCGGGCATCATGGTGATGATTAGCGGGGCGCCGGTGGTCTTCAAGTCGAAGTACCAGCGCACGGTGGCGCTC
AGCTCGGCGGAGGCCGAGTACATGGCGCTGAGCCTGTGCACGCAGGAGGTGCTGTGGACCCGCGCTATGCTCAAGGACATGGGTCACGAGCAAGTGGGAG
CTACCCAAGTATGGGAGGACAACCAGGGCGCGATCGCTCTCGCAAGCAACGCTGGCTACAACGCGAGGACCAAGCACGTGGACATCAAGCATCACTTCAT
CCGCGAGAATGTGT