Description :
From Genome Similarity Track
Location :
Scaffold_46:225048- 240557
Transcript NameFunction/comments
Hyaar_Emoy2806132PREDICTED: E3 ubiquitin-protein ligase UBR3-like
Hyaar_Emoy2806133PREDICTED: E3 ubiquitin-protein ligase UBR1
Hyaar_Emoy2806134translation initiation factor eIF-2B subunit epsilon
Hyaar_Emoy2806136predicted protein
Hyaar_Emoy2806135predicted protein
Hyaar_Emoy28061373-demethylubiquinone-9 3-methyltransferase

Sequence
15509 bases(100 bases per row)
CAAATAAACTCAATGGTAGCAATCCGAGGCAAGAAGACCGCAGCGACGGCGAAGCGGAAGGCACTAGCGGCCAAGGTCAAGGCTTCTGCTGCCAAAGACA
CCGACAACAGATGTGTCACGCGTCCTGCGTCCCAGCAGACGTTCACGCGGCACCGCGAGGAAGAGTTTCTGGCGCTCGTGCGCTTCGCTTTACAGAGCAA
CTTGGCACTGACTGGCAGCGCGGGAAAGTCGGTCTCTACTACGTGCACCACGCTGCTGACGTCGCTGTGTGCTAGTGTGAAAGATAAGGCGCTGCCTCCC
ACGCAGATCCTATCGAAGCTGCCGCGGAATGAGCGCAAGCGCGTGTGTGGCGCCATCTTCTCGGCCGACGAGATCTCGTACAGCTGTCGCAATTGCCAGT
TGGACGCCACGTGCGTCATGTGCAAGGACTGTTTCGTCCACAGCGACCACGTGGGACACGACGTGTACTTCCAGCGGACCACGGCTGGCAGCTCCTGTGA
CTGTGGCGATGTCCACGTACGTTTGGATCGCGGATTGGCTAAAAAATGTTTTTTTAGTAGTATTGATATTAATTGACTTTTTATCTTTTTTGTGAATGTT
ATTTTTCTACAATTTATGCTGGTGATAGGCGTGGAAGAAAAGCGGCTTTTGCTCGAGACATAAAGGAGTCAAGTCGTCGAACGCCGGAGTGCAAAAGCAT
AAGCTACCGAAACCCATTTGCTCAGCGGCAACTGTCGTGATTGGTGCAGTTGTGGAGCATATTTTTCAGGTGTTGCTGGGAACGGAGTATGGTTTCGAGC
TTGCAGAAGCGTTGGAGCTGTTTACGAGAGACATTCCGCCAAATTTGTTACCAATTCAAAGTGATATGGATGGACCAGATGCTGCCGGAAGTAAAGCGAG
CGCTGCATTCAGTAGAAATCGATCAACAGTGGCGTCAACGCGATCGATGCGATTATCGGCGCAATATACGGCTGAACCTGGATCGAGAACTGTCGGACCT
GGTGGCAGGCTAGAGGCACAAGCAAACGAAGTGAAGCACGGGGCGATTAGCTCAAGCGATGAAGTGCTTTTTGGCATTCGTCTTCACAATGACGATATTC
ACTCGCTGAATGAAGTGATAAATCATCTGTACGCGGAATTGGGTCTGTCCAAATCCCAGGCGCGCAGTGTTGTAAGTCAAGTAGACGATCAGGGCGATGC
AACGGTTTCAACGAAATCGCTGCTATTATGCCCGGGAGTTGTTGGAAATCTAGTGCGTCGCTCACTGAACGTCTCTGTCGCACCTACTTGGTGGGAAAAG
CAGATGGAAGGATTGCCCGCTCTTTTGGGGTGGCTGCACTATATTAGCACAACGTCAGATGGGCTGAGCGAGATTGTGTCGGAAGCACTTCAAAACCACC
GAAGTCCCGTTCTCCGAGGATTTATGCCCGCATCGAGCACTTTGCCCAAGAAAACGACGGTTCAGGAGTTTGTAAGGGAGCGCCGCATCCGCCTTCACGA
TCACGCTTTGGATGTTCTTGTTGGCCTCGTTGCTGGAGGTAAGGATGTTTACACGTGGGCTTGCGAGCAAGAAGCAGCACAGCGTCAGCGCTTTGATTTT
CGTGCGGAAGGCGGCACAGCTTCTGTGGCATCTACGGGTTTGCTCGCTGGAGGGAAACATGTTAGCTGTAGAAACATGTTTCTTGAGGAGTTTGTCAAGG
CTGTGTCACTGAGTCCGTCGTACCGCAACCACGATCGTGTCCGGCAAAGCTTTGATGTAGTCGTGGCAACATATTTCGCATCGGATCAAATGAGTGATGC
TGGCACTGCTACATCAGCTCTAGCGCTACTCATGCGGTACGATTGTACGTTGCGAAGGAACGCTGTAGAGCGGTTGCACGCATTGTTACGTGAGCACCTG
GTTGACATTCAATTTCGGGCTAGCATGCTAGAAGCATATTTGCAATCGTACGCCTCAATGACCCGTATGTTCCTCCGTGGCCTGGACAATTCGAATGAGT
CTATTTTCGATTTTGCCGAGCAGTTCTTGACTGTACCGCATCTGGTACAAAAGTACACAGCACACTCCAGAAAACTGGAGCTGGTTCGGGAATTACTTTG
TGCTTTAAACACAGTACTTAAGTCTGCTGTCGACGACAAGAAAGGGAGCGTGAACGCTGACCACCCTGCCCTTAGCAGTCAGAAATATAAGGTAAGTGTT
GTTTGGGTGATGACAGAGCCATCGAAAACTCACTTTTTCCGATGGTATAGCACTGTGTCGAGAACATGGAATGCGTATTCAGTATCGGTGCCCTCTCGAG
CGATCTCGTGTGTAGCGCGGAAAATTTGAAAATTTGGCTTTCTTGTCTGAGCATTCTTCAGGTACGAGACCGAATCGTTACTGGTGAGCGTATTGTATCA
CTAATAACGTTTGATAATTTTGCTTGTAAATAAGGGTGGCGATCCTCAAGTACGTCGGGGCTTTCACCAAAATCATGTGGAATACGAATTAGACAGCTGG
TTGTCAATGTTTAATCTTGGTATTCGCATTCACTCGATTTTTGCGATCGCCTGGAACGGTTTTCACCCAGTCGAGTTTGTAACGCCTAAAGTGGATGTAG
CTGCAATAGTCCGCCCTATAATTGAAGCCACCATTTTGTCGTCTACCCGCGCCAATGAACGAGCGGCGAAGAAGACGTTGGTTTCAGTGACAAGACTAGT
GTGTGGGGACAAAGGGGTTGCTGGGAATCAAGAAGAAGATCGTATCATGACGTACGACTTTAACGTAGCATCCCAGCCAACCTCGCTCCACATACCTTTA
CACCGTTTCCTGACAGCTGCTGTGCGGCATGTCTGCATTAGTCCAACAGGTTTAGGAGATTCCATTCCTTCAGACGGGATTTTGAGAATTTTTGGGTTTG
ATGAACTGCCGGTTGACATGCAATGGGAGCTCGTGGAGATGCCACTTCGATGTTTGGTGATGGCATCTCAAATCCACTCCAATCTCTGGCGTCGAAATGG
AGATGAAAATATGCTGGCACAGCTGTACAACTATTCAGCTCTACCTTATTGCATCCACTACCGTGACGCCGACACACTAATGCTGCAGCTCGGTGTGCTC
ATGACTGGCGCTGATGCCCTTTTGGCACGAATGATAGATCGATTTCAACTTGGCAGTTATTTCACACTGCCTCGTAAAACTTCGTTAACAAAATCCGATC
AAGATAGCTCGACAGGATCTGACGGTTTAGTGAAGCAGCTTGGGTTTGCGGAAGTAGAACAGGGAATAGATAAACAACAAAGCCTGCAGATGCTTGAGGA
GTTTCTGCGTCTCGTGATCACACTTGGCACGAGTCTTCCGAGCACGACTGGTTCAACGTACGATAACGAGTATTTGGCGGAAGAGATGCTGCAGCAGTTG
TGTGCAAAGTCACTACCATTTAGTAAGCTCTCTGATCTGGCTGTCCTGCCATCAGGCCAGGATGATATCCCGACAGCGCGGCTGGAAGGGATCCTCGCGA
CTGTGTCTGATTTCGTGCCATCATCTGGGCTTGAGCCGGGTCGTTACCAATTGAAAGAAGGTATGCTAGAGGGCTACAACCCGTACTTTCTTCACTTGAA
CCGTGAAGCGCACGAGCTAGCTCGGGATCGTTGGACGACCTACCGCAATACGTGCCGTCTGAAGTTGAACCAAGCTACCTCCGATAGCCCCCCGAAGGAG
CCATTGAAGGCAGTGAAACCTCCGGTTGATTTCTTACGCCCAGTCCAAGCAATCCTGACATGCGAGAGTACTGTGGCGATTACCCATGTTATTCTTTGGA
AGGTGCTGTCCTCGGGTCATTCTGAGTCAGCGTCGGCAGGTTCGGAGAAAAGTGTCTCCGACGCTATCGTTTCGACTTGTTTGCACTTGCTGGTCCACGG
TGTCCACACGGCGTCATTTGGCTCTGATCATCGCTTCTGGACTCGACTAAGCACGGCAAATGCTGCTACCTCTGGGTTGTCACTTCTAAACCTTTTGAGC
CAAGTACTCGAGCGGGCGTCAATTTTACTTGATAGCGAACAGATTGGTACGGTCGAGTGGCTTATTTGGAAAATTTCTGCTGAATCATCTGTTTGTCGAG
AAACATTTGAGCAGTTTGCTCGTGATCCAGGGGAAACACTAAAGAAGACGAATGTGTCGCTGTTGTTATCGAGTGGTTCCGTACAAGGTGGCCCTTCCCA
GCCGATGACCCTAGAACAACGAAAAATAGAGGCAAGGAGAAGAGCAATGGCTGCAATGGCAAAGCGTCAAGCCGATTTCCAAGCGATGGTGGACATCTCG
GATAAAAAAGGGCAAGTGAAAATGGATGCGTTGGCGGAAGACAAGTCAATTTATGAGACCCGTTCGTCTTTGGGTAAGCGTAAGGCTTCGGCTTCTGACC
AAATGGAGGAAGTTACGTCAACGGACCGAAAACTAAATAATGAGCGAAGCTGCAGCTGTATTCTTTGCCATGACACCTCGAACCAAGGCCAGATGGGAAT
CGCAGCCTACGTTCATCAGTCCACCGTCTTAGCTCCTGGGTTTAGACCAGAGCCAAGCGAAGCGCTCGGCTTAGAGGGCAGGAAGACGCGTATCCGTGTG
AAAAGTATAGTCGAGAAGATGGGGCTGTGTTCAGATGGCGGCTCGGCCTCATCTGATATTGCGAATTTGTCGCCGACCCTGCGTGCTTTTGCAAGCACTT
TTCCTGAATGGTACATGGACAGCATGTTGGATGATGACCTTACTCGCGATAACACGGCAAATAATAGTCCTCGAGCGCCAACGACTCGCCGCCAGCGCAA
CGATCGCATCCGCTTCGGTAACGGAAACATTCCGATACTCGGAGGTGAGCTCCTAGAGACGGAAGAAGATTTCGGAGTTCTTGAAAGCGCTTTGGATCTT
CGTGAGGACCAACGACTTTTCCCAGTGGATGGGCGCGGCATTGTGGGTTTGGATCGTCGTGGCGATGTGATTGAATCACGTGGATTGAGAGATCATAACG
CAGCTCGCGGTGGCAATACTCGTGACCAAGGTGGGGATGACAACGAAGAAGTAAGTCTTCCCCGATTTCGCCCAGAACAAATACCACCCGGATTCGGTCA
GCCTCACCAAAGTGCCAAACTGTATGTCACCCCATGTGGATTACACATCCGTACATGCCAGCACGCGGTGCACATCCAATGCCTTGAACGCTACATCACT
TCATTGCATGACAAAGCCATGCGCGGTGAAGAATTTGACGGCGTTCAAGCAATCGACCCGGATTCAGCAATGACGCAGTTTTTGTGTCCTTTGTGCAAAA
CGTTGAGTAATTTCTTAATCCCCGCATCGGCTCCTCATCTTTCCATCGAAAACGGGGATATTTGTGAGTATAAAAGTGCAATAGGTGCGCCGACACGCGA
TGAAGAAGGGAAACTTGCTTCTTGGGACGGTATAGTGGCGGAACAATTATTAATGCCTGGATGGTACCGCTCAGTGCTCGGGCGCGACGGTAAATTCGAA
GATAGGGACAACGATACTGAACACGACTCATGGCGGGATTATTACGAGGAAACGCTGTGGGAACCTCATGGCAGTTTGGAAAAGGGCGCACCTTTCCTGT
GGTCTGCGTGTGCGTTCACCCTGGCCTCGTTTTTAATTGTTGCAGAAGACGAGTGTCGTGCAGACCCCAGCTGCAATTCAACGTTCGATCCACTTACAGA
CCGATGTCCCCCATCGATGGAAAAAGAGTTTGAGTCGCTGATAGCAGTCACGAAGTTTTGCAGATGGACGTTCTCGCTTTTGGAGCATAGTGCTGACGCG
AAGGTGATTTGGGAAACCGCTAAACGTTGCTGCCCAATCAATACCGAGACAAACCGCGAGTACCGCAAGTATACGAAGGTAGGAATTCTGCTGACTTCTG
GCGAGGATAGGTGCCGAGTGCGTCGTCTGATAAATAATGTCTGTAATGACCAGGTCCTTGGTTCGATCGATGCTTGTCTACGCGGAACTATTCTGGGTCT
GCTAGTAGCGGACACTTTCACAGTACGTCACGAGATCTGTAAAGGTATCTATGGTCAACGCTAACGGAGTATGTGTTGCAGGCTTTCGTGGTGGCCAGCG
TGATCGCAGATGGACTTGAGACTATTTGGCGGTCTATTCCAGTATTTAGCGCTGCTGATTTGTTACAGCGTCTGCATACCGAATTTTTTCAGCCTGGCAA
GCTTGAGGGAGTATCGCTGTTTGAAGACAAATCGTCTGCCGACGCAACTACCGAGGCAGAGCACATGGTAGCCACAGCTACGGCAGCGACTAGCGACTCT
GCCTTGGCTCCGCGTCGCACTCGAAGTGGCCGTGCTATCGGCTGTGCCGCGAGTACTAGACCTACTGAGGCTCCCACGAGGTCCGCAAAAGAGTTGATGC
GAGTGCTGGAAGCTTTGGGCGAGGGGGGCTCTGAGACATATGCTGTGCTGCAGCTTTTGCAACGAATGACAAAGGTGTATTCTGCCGAGCAGCTAAAGCC
ATTCACGACCGCGGGCAATGTAATCGTCCGACTGAAGCACATTGTAGACGCAAACAATGCTTTCGTGCGCCGCATGAAGTTATTCTGGCGCTGTCTGGCG
AATGAAGGTACCAGTGCACCCACAAGTACTAGGACGATGCAGATCCCAACATTGATCGACGTCGCTCGTAGCTCAGATGCTACATTTGACCAAATTTGGC
GATGGTGCATGGACCGTATGCTCAGCAAGGCCTACTTGGGAGCTTCAAAGGCCGGCGACAAGTGCGAACACACTGAAGGCTGCAGCGAGGCCTATGTTGC
TAGCATGTTCATCCTTCGTGACATACCTACGCGACCACGATTAATCGAGTTACCTATCCAATTCGACGAGCTTTACAGTGAGATGGCAGGCCGCAAATGC
ACGCGATGTGAAAAAGCGCCTTGCGATCCGGGTCTGTGCTTAATATGTGGCGAGTACCTGTGCTGTGGAGATTCGTGCTGCACCCGTACCTTCATGCCAC
ATGGACCACCGGTTGGCGAGTGCACGCGCCATGCTGCAGAATGTGGAGGTGGTGTGGGCATTGTACTTCTGCTCGAACAGTGCCGCATCGCGATTGTAGG
AGGCAGTATGGCAGCGTATTTTCCATGTCCATACGTTGACTCCCATGGAGAAGAAGACGTGGGCCTTCAACGGGGACGACCGCTTCGGCTAGATTTGGCT
CGCTACCGGTATCTCGAGTCACTGTGGCTCAAGCATCGTATTTTCACGGAGGTCTCGCGCCAGCGCAACCAGCGAGACCCGCAATATACGATCAACCTGT
CGTACTTATAGGCGGGGTGGATCGCACATTAGAGTACAAAGGCGATGCAAGGTATACTGCTGCAGGAGAGCAGCGCAGGAAAGTAACGGTAGTTCCACCA
ATTTACCTTGCAATATTTGTTGTCCTGCCGTTCGCTACCTCTTGCAACGACAGGCGTGGCAGGTCAGTACCAGACGACAGTGCCGTTAAAGAGCAGGATT
CCGACGATCCGCGCAAAGTGACGCCAATCAAAGTTCCAAGGCCGTGGACTCCGCTTATCTTCCAAGGTCACCGTAATTGAAACTTAGATCCGGTTCCGCG
CACGCACGCTCTTCTTGGCAGTCTCCACTCCGAAACTGAACATGTCGGCACTATTCGTAGGAATGTAGATTCCTCTTTACCGTGCCGAATAGATGAGTGG
CTCTTCAGATAGTAGCATGACTGTATCGGACGACCACCCGAACTTATCTTCTTGCCGGGTGCTTTCTTACCAATTCCAGCAACAAAATTATGTCATGCCC
AAGCTCCTGAGATCGCTTTCGGGAAACCACGCTTCGCCACTTGCCGTGGACTCCTGGCAACAACAAGGGTGGATCCAGTTACAGTGACCACTTCCGGCGC
CAGAAGACAACCTTCTATCTCCGTATCACTATTTGCTCTGTAAGAATCAAGAGGTAATTTCTCGTCAGATCGTCCGCAACCGTCGCAATGAAGCAGCTCG
AACATCAACTGCAAAGCATCTTTCCGGCATATACGAGCATCTTTTTTTTCGTACGAAACTAGTTCGTCAGCAAACCCACAGGTCGACGAGCAACAATCGA
ACAATGAAGCTGTCTGGTCCTTCCCGTGGCAGTTTCGCAGAAAACAAACGTGACGGCCGATTCGCAGCACCCTCCAAGCTGTCCACTTCACTGCTTCATC
CCCAACATATGACACTCTAAAAAGTAAACAACATTGCGGCATTTACAGCAGAAATTCGTCACCGAGCTTCGTAAGGCTGCAAGCACAAATGCCGACACAA
ACGAGCAAAACAGCCAATGGATCTCTAGTCCAAGCCAGTCTGCTATCATGTGTCGGCAAATTCGCTGCAGCACCAGCAGTCCTGCGCGGTATACTCAATC
CAGTCAGCCACACTCATCGTAGCGTACACGCGCTGCGAGATCATAATTGTTCCGACCATGTGTCCCAAAAAGATTCACAGCAGCCTTGATCAATCCAATC
TAGCATCCACATTCCCGCTCGACGGTAAGTTTAGTCCAAGTTGACACCGTTCAGTCTGCCTGACTCACCGAGTCGATTAGTGACCGTGGAACTCGTGCTG
CCGTGATTACTCGGAATTTTAAATCGAAGCACGAGAAACTGCAGTCCTCGTCGGAAGCATGTGTGTGTAGGCGTTGCATCACGGCACATCGCACCGTAAA
ACTGTGAGCCTCTACGCACTGCACCTAGTGCGGTTAGGTAAATTCATCTTGCGAAGATGATTAATGAGTTCAACAAGCCCTGAACGTGCGAAGCGACGCA
CCAACAAGCGGCGACTTGAAATACTTGACTAAGTCGAGGAAGATTGGTCATTGCATTGGAAAAAACGCATCGTCTGTCAACCCTTCAAAAATATTCACAT
TGTTCTCACCATACACCGCAGAATCTAGAGGCCAGCTCATAGCGTTCCCTCCTGTTTGCGGAGGTAACTGTTGTGGAAGTTGGCCAAGTTGCGGAAAATG
TTGCGGGGTAGGCTGGAATTGATGTGCCGGCAGCGATTGCGGCATAATACTTTGAGATGATGACGCCGGTGTGTCAACACTTGCTCCATATCCGAAATTG
TTTGACAGCATAGATGCTCCAAAATTGGTTCCGTTCATGGACCCCATCATCTGATGTTCGTGTTGCTGCATGGGCATGCCCATCATACCACCCATAGAGT
ACCCAGATGATCCGAAATTTACATCAGAGCCGAATCCGAGTGGAGCAATATATGGATCCACCGGAAAGTTGCTATCACTATTACTATTGCTGCCATTTCC
ACTGCTGTATACGTTTGTAGGTGCTGGTATCGTAGGCATGCCATAATTATTGTTATCATACATATTTCCACCCGCCAGGTTCATTGGCATCGGCATTGAC
ATAAACTGCTGCTGCTGAAGGTTCATCATACCGCCGCCCATTACATAGCTTTGCTGGTTCGTAAATCCTGCGGACAAGCTGGGAGGTCCACTTGTGGAAG
TCATGTACACATTTGACGTAAGTGTGTGGCCAGTGGAGCTCATCGAGTAGCCTAGGGCCGATGCTGCTACACCAGAGGCTGCCATCGACGTGACTGACGT
GAATCCAGCCGACGTTTCCATCGAATCCATCTGTCCCGAGGGAAAAAACATACCTGGACTCGTTGACGTAAATCCAACAGGCATCGGAGGGTCAGGAAAC
ATAGTCGGCGGTGTCGGTGCAGCCGTATGCGACACCGTCATCGCCGTCGACCGCGTGCATGCAGGGCGTATCGGAGTCGGCGTCGTCGAAGCCTGCCGCG
GCGCGTACACCGGCCGAGGAGCAACAGGAGTCAATTGCTCCTGAGCATGTGAAAATGCAACACGACCAGCTGAAGACGCCGGTTTCTGCGACGCCTTTGC
TTTTCTTGAAACTGCTACCGAAGAGGAAGCGGCTTGTCTTGAAGCTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTACGCCTGATGTCACACTGCTT
GTGATCGCGCGACGCCGGGCGATTACGAGCGGCGGGATATCGGTTTGTCCATACGCATGAGGACGCAGTGCCGCGACCCGTTTTATAAATGAGAGTAGCG
CTGCGACTGCGATACGCCCAAATCCTGGGGAACCCGGGGCTATCAGCGAAGCCAGTATCTCGAGTCTAGCTCCAATCTGCTTACGATATGTTACACACCT
CTTCACCCACTCCTTGTGCTCTGCAGACTTTGTCTTGGCAGCTGCAAAGACGCAAGAGTCCAAAAATAATAAAACACAAGAAAAAAACGCCCAACACAAC
ACCAAACAGTCAACACCGCATCCTACAATCATTCCAATCGTATCCACGTATTTCTCCGACGTACGCTGTCGTTTATGCAGCGCATTCCAGCCCCTCAGCG
CCGCCTCATTTTTCTCCAACATCGTCTGGATCTCTCGTTGTGAGATTGATCGACTTGGACCCCACAGCGCCTGAAAAAGGTAGTGCATTCCACAGTCAGT
GAATATCGTTAAGTAACATCTACGGCAGGTATAAGCAGGACGACTAGACCGGTCCATTCACACACCTGGGCAGCGGCAGCCGCACGCTGTTGCAAAGGAT
TGAGATGCTGCTCCCTATATGATACAAGAAAGCAATAGATACACACAACAGGTGAGAAGCTGGCGATGCAGTAGCAGCGCAGAGTCACGTACGGCATCGG
GAAGGACGCCATGCTAAGGGATTACTACTGGTATGGAATAAGTACTGACCGCTCAGCCAATCACAGGGCAGTGTGATATTGTTTTATTCACGCGAAAAAA
TAACAATTATTCAGACACAGGCGTTCAATGTCTAACAATTTTTAAGAGCTAAAGTAGTTGCTCTAAGTGGTTCTATCGAATTCAATCGAGCTATATTAAT
ACACCGAGGCGAGACGTTGTCACCGATGCAGCCAACGTGTGTGTCTGCGCCTGGCAAAGTGCTGCTCGCGGGCGGGTATTTGGTACTTCACGAGCAATAC
ACAGGCATCGTCCTGTCGACGACTGCGAGGTTCTACGCTCAAGTAAATAGCCAGGTGCATACGAGCTACTTCTCCAGCATCTGTGTTAGAAACAGCTTTA
TTATGTTTCTATTGTGATTTTTGCCATATATGTATTCTTGCAGGTTATGGAACCTGACACGATTATGTGGCCAGCTTCGAGTAGATGGCGTCCGTTGTTC
CCATTAATAGTGGAAAGTGAACAGTTCAAGCAGTTGATCGACGGCTGGATTGAAGAAAAGAAGGACGGACGGTCGTTTCGATTCCAGCTCAGGTGATACG
ACGAATAGAGCGCTCATGGTTGACGATGGTGGACAGTTATGTGACATTGATGTGGCACGTAATAGGAAGAGTTCGCATCGGAACGTGTACATTGAAAACA
CCGTGTTGTGTGCGGTGAATGGTATCGCTGGGTTAGAACAGTTCAAGAGTGAAGACACTTTTCGGAAACTAGCGGAGACCAAGAAGCGGGTTCACGTTCG
ACTTCGGGGCGACAATGACTTTTATTCCCAAGTGCAGAGGGTTAGTAAGAGTAGAGGGTGGGAGGTGGTCGTGAATACACTGACGATGCGAGTGGTGATG
CTTGACTAGCTTCAAGATGCCGAGCAGCCACTTCGTCGCGACAGCTTGAAGACACTTGAAGTGTTCCTTCCTCCTACGATCGAAGGTAGGCTTTATCAAT
GGACATTGCTTCGTGAAGATTACTGATCATGACGGTAGAGCGGGATGGCAAGCTCGTTGCATTGAAGACAGGCATGGGAAGCTCTGCTGCTCTCGTGACG
TCACTGATTGCAGCCCTTGTGACGTTCTTTGTACCGACTATAAGCTTTGAGGAACGGCAAAGGGATCTAGAGCTGGTGCATAACCTGGCCCAGTTGAGCC
ACTGCTATGTCCAGCGCAAGGTGCGTGCTGCAGTTTTTTTCTTCATGCAACAAGACGATCGATTGACAAAAATGGTGGGATATAAACAAACAGATCGGAA
GCGGCTTCGACGTCTCAGCAGCATGCTTTGGTTCACAGTTGTATTCCAGATTTCCGGTATCTGTCTTGAACACGTTTACGTCCGAAGACGCAATAGAGCC
GCAGAAGATTGGGCCTTGCATCAGAGACCACGCATTGTGGAACACTTCTAATCGCGTGGTAACCTTTGCTGCTCACCGGGTTGGGATTGCGTATTCTCAC
GAAAGTTTGTGCCACAGAAGTCTGCCCGATTGCCTTCTACCTTCCACATCCTGATGGGAGACGTGTCATCCGGATCGGCTACTGTTTCGATGGTCCGGCA
AGTGTTGAAGTGGCAAAAAGATCAACCTAAGCATGCAGCACGAGTGATGGATGCAATTCATCGGCACACCATGGATGTTGAGCGAGGCTTCGCTGAAATT
TGCGATTTGGAGACTAGCAATACAAAACGCGGATGGAAAGAGATGGCTGCTGTAAACCGCGACCAGGTAAGCGCAGTATCATTCCTTGAGACGTCTATGC
ATTGGCTAGCTCACCACCGGATGAATCAATGCTACTCGTATCTATAGTGGGGCATGATTGATACTAAGATCGGGGCCGCGCTCATGAGAGTGAGTGTTGC
CTACGCAGGTCTTCGACAACTAATGCGGTAAGTCGTGCTGGCCTGTCTGTGTGTCCTTGCAGCACGTGTTGTATGATCAACGACTGACAATGTCGCCTGC
ATCGGCATCGAAGTGAAATGGGGACATCTGCTGGGGTCTCGATCGAGCCACCAGAACAAACAGCGATCTTGGATGCAACGTTAGCGATTCCTGGTGTTTT
GCTTGCTGGAGTGCCCGGAGGTATGATCGCGCGTTTACATATGTTGTGTTCGTGCGCCCTCACGTTCAACGCTTTTAGCCGGCGGATACGACGCGATTTG
TGTGATTGTGCTACACGAGAGTGTTTTGCAAGCAGTGGAAGATTTGTGGGTCCGATGGTCTTTAACACATCCTGACTCTGTGTGCGTCTCGAGCAAATGC
CGTGTTGTATCCGTTGCGCTTGGTTTTACAAATGTGTGTTCTACTTATTTACCAGCATTTGCCCACTGCTGTGCGATGTCGACCGCGGACTGACGAGTTC
GTTACCTGCAAGATCAGGGCTTCGAATGCACGCGGTTGAGTAGTTTTGTATTTACCTACGCTACTCTCCTGTGCCGAATAAATGAAGCTGGACTAACGTA
CACGAATAGTGCTCAGAAAACAAATGGCTCCACACTTCTATAAATGGGATGACAAACCACCAAAACCGGAGTCATACGCAAACGCTATTCGACGGTCACC
AGTCAAGTACGCAGAATTCAATGAAGCGGAAAACGCGTGACGGGGACAGCGTCGAGGAAGACAGAGAAGAAAAGGTGAGTTGCCAGTTGCGTAATGTAGA
CAAGACTGATCAGACAGAGCAGGAACAGCCCGGACACTTCTCAATTTGTGGATTACGGTTTGGGACAGAGTCCTGGGCGGGGATGAAATCTAGCAACGAA
GATCGACATGTGTCGTCCGCTGACTTTTTTCCTGGTCCAGTATTTGGCATCTTTGACGGCCACGGCGGGACATTTTCAGCGAGCTTTTTGTCACGGCAGT
TAGTTAAGACCGCTGCTTCAGTGATACGACAGGTTATTGGGGAAAAAGCGCTTGCAGGCCTACGCTGTTCTCGAGATCGGTCAATGCAAGAAAAAGCTCG
CAAGGCCGCTCTTCGAAAACAAGCGACGATGCTGCGCCAGCAACTCGAAGAAGTGGAGGCAATGAGGTCAGTCACTGCCGTGCCAGCTTCCGAGAGCTCT
GCCAACGATTTACACGTGTTAGCCGACCAACTCTCGAAGGCTATCGCGGAGATGGACAGCGAAGCGAAGCAAATTGACGTCGAGGAAGCAGAACGCCAGA
GAAATAGGTGGCAATGGTGCAGTAGACTGCACAGCTGCTTCTTGAAATCGTTCAGAGAATCCTTCAGGCGAGTGGATTTGCAGATCTTGCAGAAGAATCC
ATCACAAGATGGGTCCACGGCTCTTTTAGTTTGGTTCTTAGCTGACTCGGTCAATTTCGATGACGACGAAACTGCGGCAACAAATGGGGAGAACAACACG
CTGAGCTTCTACGCCATAAATGTAGGTGACTGCCGAGCAGTTATGTGCCGAGGTGGTCGAGGTGTGCCGCTCACAAGTGATCATAAACCCGATCGTCCGG
ATGAAAGACAGCGGATCGAGAAGGCGGGGGGCTATGTGGGCAAGATTGCAGGTATTCCTCGCGTGTACTCTGCGGCAGGAGCTGGGTTGTCCATGCGTCG
TGAAGTGTCTACACATTTGGCGGTCTCGCGTGCATTTGGTGATCAATCACTGAAACATCCAGCGCCGCTCGTGTCGTGTGAGCCAGAGGTGGCGCGATTC
CAAGTGCTCACCGACGATTTGTTCCTCATCTTAGCTTGCGATGGCATTTGGGACGTCATGAGTGAGCAAGATGCTGTTGATATCGCTCTGCCACACTTTC
ACGATGCCAAAGCTGCGGCAGGCGCGATCGTAAAGGCTGCTTACAAGAAAGGAAGCTTGGATAATCTAACAGCCACGGTCGTCCAGTTCGCATGGAAGAC
CGGCGATCAGCTACAGCAAGGAATTGATACCAGCAAAAAAGTGACCAAAGCAAGGACTCGTAAGAGTGAGCAGAACTTGGCTTCCGCAGATTCACTCGTT
GGCAATGGGTCAGACGACGAGATCGACATGTTCAATCTGTAACTCGCTGAAGCTAAGGCGGCGAATAGCTCCGTTTGTACGGTGCAATGAGATTCCGTTG
CTGGAGCATCTGCAGGAACACGCGAAACACGAAGTCAACGCCTCGATCACGCACGCTTGCCTTAACCACAAGTATCAAGAACGAAACCTCTGCAATTGGC
GTCATCGTATCCACGTCGTACACGTGGAAGCGAACACATGGCAATGCATGGCGAGCACGTTTTCGCTGGTCCTGTTTGCGTTGATGCAGTACATACTTCT
GATCCACGACCACCTCAGCCTCTAGGAACGACCGAACGAACAAGTTGTGCTGTGAAACCTCTCGAGTCAAGCAAGCGGTCGCTCATTTCACCAGGCCGTA
CGTACCTACGCGGGGGATAGCAGATCCGCTATTAATCACGATTGCGTGCAACGTGATGACGGAATCTGGTGATGGGACGACGCGAAGTACCCGGTACTTG
GTATCCAAATGCGTCTGCAGCAAGTCTACAACTGTGTCAAACTGCACGAGGAATGAGCTGTCAAAGACCAAGAAAAACATGGAAGCAAGACACGAAAAAA
AAACAATGCGTACGTCCTGCTGGATGTTTGCTTGGCGTCGGTCGCGCTCGCTTTCAAGTTGCAAAAGGCGGTAAGTCGCGAACAGAATCGCTACGACGAT
TACTACGCA