Description :
From Genome Similarity Track
Location :
Scaffold_24:22504- 25305
Transcript NameFunction/comments
Phyta_totarag1318conserved hypothetical protein

Sequence
2801 bases(100 bases per row)
ACCGATGCGAGGCCAGTGGGAAGCCGCGCAGGCAGGTCTCCGGGTGTTCTtggaggaagacggcgacTTCGTACACTTCGTGGAGAGTATTGAGCAGGAC
CTGACGCGGAAGTTACGGTTCGAGTGTCGGTCGCGAGGCGGAACCCTCGTGGAGAGCGTCGCCTTCGACAGGTTCGTGGAGACTGCAGCTCAGCTCCGGT
ACCTCCATGTATTATTCCAGGACAAATTGAAGGCAGTAGCGGggcctccagcacgtggaGATGCCAGTTCAGTCGCCGGAACGTGCGACAGCTTCGTGGA
GATTCTGGCGGATATGCTGCGTGTCCTCCGCGTACTGTACGGACAGCTATTCTGCAGAAGGGAAGCCACTCAAGCAGCACTGGAAACTGTGTTAGCGAAG
GAAGACAAAGGACGGgacggcgagctgctggagaagtaTCTGGAGAAGCAACACCTGACTACTGAAAAGCTGGTCTCTCGTCCGCTGAAACGGTTTGATG
AGCTGGTAGAGTTCGTCGAAGCGCTGAGCAACACCCTATCAGAGgatggtggagatggaggcgtAAACAATGATATCGATGAAGGCAGTGAAGAGAAGCT
CAATTATGCTCCTCAACTGATGCATATCGTCCAGGAGACCAAGCACTATATTCACCTTGCCAAGGCTGATTCacgcgaggagaaggaatTGATTGCGTTG
CAGACCTGCTTCTTTGGCGACGGAGCTGATGCTTTCAATGATCTGTCCAACAATaagttgttgctgcacgGAGAAGTGTGCCTGTCACTTTTGAGGGATC
AAAGCGATTGCAGTGGAGTTGATCCAGAGGCCGGCACCAATACGGGACTGTTCAGCCAGTCGGAGAAAATTTACGTGCATTGCTTTCAGGACGGGGCATT
GGtttgcagcaagcagcaggacacTGAGTTGGGGGTTTCGTTCACGATCCAGCATCGCCTACAGCTGAAGCAAGATGCAGCATTTTTGGAATCTGTTCCA
GCCAGCGTACCAGTGCTCGAATCTTCAGAGGAAGCACGTGCCTTGGCACTGATTATGAGAGACACAACACTTATATTTGCCTGGAAAGACGCAACGGAGA
GTCAACGATGGACTGATGCTATTGGGGGGTTTCTGGAAATGAATGGGCCACGGACCGAAGTACTTCACCAAGGTCGAACGATTGGAGACCTTCCTGTTGG
TGAGGATATCTCAGCCCAGCTTGTAGAAAAGGACACTATACCGACAGAGTTTGCATCATTCTACGACGATCATCTTCCTGGGGTTTTCTGGATGGCACCT
GGTAAGGACTCGGACCCGACTCAGTGGGAATTGGTAGAAATCGTCTTCTATGCTAAATGGCTTTTGGTTTTCAAGCTCGAAGGATGGAGTAGGCATTCAG
CTTTATGCGATTTCGATACGCACGCTCCTGAGATGGAAATCAGTGAGCATCCCCGAGGTGACAAAGAGTGGAGCTTGGTTATTTCCAATGGATCTGCCGG
CAATCTCACGCTCGTATCAAAGAAGCGAACAAGAATCGACTTCTGGTTTGATCAAGTGTGGAAGGCAGTTGAGAGTGCTCAGGTTGCGTCAAGACGAGCG
GAAAGAGAAAAAAGAGAGCGCCAAACAATGGAAGAGACCCACGCGTGGGGTGGCAGCAGAAAGCGGGGTGAACTTGCTGGGATGAAACGAAAGCTCATGG
TGGCCCCTGATACTGGCGAAAGCCCAACCGATCTGGTAAAGGAGAAACGAAAATCCTCCTCAAATTCAAGCCCGACAGGCTCCAGTGGCTCAAAGCCAGG
CGATAACACGGATGAAGAATGTGGTGGGCCGGATAAGAGCTCCACAACGATCAGTGTGGAAGAGAAGCAAACTGCTGTGCCCCCGGCAAAGAAGAAATCC
AGGCGTTTATCCGACAAATCGAAGCAGACATCAGCTACGATCTGTGCTGAAGAGAATCATCCTTTTGTTGCTATTGCCTCGCCAGCTGTAAAAACTCCGA
AGAGAAGGTGGCTGAAGAGAAAGTCGGAGGACCCTAATGACACTGCCCTAGTGCCGACTCAACCAAGCCCAAGCATTCCAACGGATGAGTCTACGAGTGA
GATTGATGTTACCCAGCTTCCCGCTAACGAAGAACCTGCTGAAGACGGGCCGAAAACCCAAGAAGTGCGGATTATCCTCACTGGCATTgagccaactgct
gcaatcCGAAAGAAAATTGATTCAATAGCGGGTGCTGTCTATGAGGAAGACATCGAGAAGGCAACGCACATTCTCGCCCCTAAGAACCAACTGAAACGAA
CTGTGAAGTTGCTTTGCGGGATCTCGCGCTGTGTGCACGTCCTGGATGTGCGATGGCTTGATGAGTCGGCTCGCGTGGGCACTCCTATCTATGAGCAAGC
GCACTGTTTGAAGGATGCGAAGGCAGAAACAAAGTGGCAGTTTGATCTGCGGAAAACCATGTACGATTTCACCCctgagcagcggcagcagctctttGCC
GGTCATCAAGTGTTCATCACCAATCACAAGTCGGTGCTCCCACCAGTGAAGGACCTGGTGAAGATCGTCGAGTGCGCCGGTGGAACAGCAGTGATCAAGG
GTAGCGCCGGCCCGAGTGATGTGGTGATCACAAGCGAAGCAGCGCTGGCCACAGCATCGGTCCGGAAATCGCTGACGCAGGCGAACCCGCAGCGGATCTA
CTCTGCGGAGCTAATTttgagcagcatcttgcagcagctcattgaTTTCGACCAGTACCGCCTCGAGCAGACGGATGGCGGAAGTCGCAGACGCAAGTAG
A