Description :
From Genome Similarity Track
Location :
Scaffold_20:225018- 226625
Transcript NameFunction/comments

Sequence
1607 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTCGTAGTCCGTTCAACGACCATGAACATGTTGGACGATGAGGGAGATGATGCTCATCCCACGCATGAAAGCTACTCCCA
TTTGAGTCAAATCGAATGGGACGCTGTCGAACGTTTAAGTTCAATGATAGGGCAAGAAGCCGTTTGCGCACTGCTGTCCGCCCTGGGGCCAGACGGACAG
CACCCCACCAGCGCCAAGTTCATTCAGAATGAACTTGACGTCGAGCGGGGAAAAGTAACCTTGCTTCACCAACAAGGTTCTCAACAAACAGAGCTGTTGA
GAGAACATAGTGCTCAACGGTTGAACTGTTGAGACAGCAGCAGGTCACTGCTACCGGGTCGACGTATACACGTCGACCCGAGACTCTAAAGATTGACATC
TCAAATACAAGGGAGCCGATGAAGACTCTCTGTTAAGATGGTTCGTGGAACTGTACGATGCCATAAAGGCTCGCCATATCGTCGATGAGGAAATGCAGAT
TGCATTTGCTCAATCGAACTTGGCAGGGCGTGCAAAGACGTGGGCCTTGGGCCTTAAGTTACACGATCCATATGTCTTTGGGTCGTTGGAAGTCTTCAAG
TCCCTGCTAAGGCAAACTTTTGAAGTTGAGTTCAGGGCTCGCTCTGAACTCCTGAGAATCAAGCAAGATAAACGTGACATACACTCGTAAATTCAGTACA
TACGTCACCTTAGCAGTTGCATAACAGTCGACCCACTGAACCAACAAACGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTGTTAAAACCTA
CCTGTTCCGGTTGGAGTTCAACACCCTGGAAGAGACAATAAGGGTTGCGGAACAGGAGGACTTCAGCGTGGAACAGGCTCACGCGAATTCGATTTCCTAT
CGTCCGTCGAGACGACAGGAAAATGGAGGCCTAAAACCAATGGACCTCTGTCACGCGGGGAGCGAGATCTCTCGTGTTAACAACTACAAGAAACTGCAAA
AATGCAATAGATGTCAGAAGACAGGGCATTATGCATATGAATGCAGTGACCCGAGCGCGGTACCAAATACCGCAGGAAACAATAACCGCCAAGCGGGGTC
TAAGGTGGGTCCGTCGTTGTTGCGAAGACGCAACAACGAATCGGACAGCCAAAAAACGGTCAGGGTCAGTAGGTGCGGAGCACCCTACTGATCCATCAGC
GTCAAGTGAGTTTGCAGGCCTTGACGAAAGTCGCTCCCAACACTCAGTCATTGTGTGTTGATGCTTCTGGCAATGAGGTTTCCCTCATTACCTTGAAACT
CGAAGTGACACAAAACATGTCTCTTTGAGCCCTAGTCGATTGTGGGGCGTCGAACAACTGTGTACGACTCGAATCGCTAGACAAAAGAGAGCTCGAATAT
ATTGATCGAGAGATCCCTCCAACAAGTATGACGGTGCGCCTCGAGATAGGCGCATCCGTAACATTGATGAAACGTGTAGTGGGTATTACCTATACACTAA
AGGGATTCCAATATAATGATGACTTCATAATATTAGACTTGGATGACAAATTTGATTTTATCCTTGGACTGCCGTGGCTCAGAAGGTACGAGCCACAAGT
CAGCTGG