Description :
From Genome Similarity Track
Location :
Scaffold_1026:225- 1933
Sequence
1708 bases(100 bases per row)
TAGCcgaCCGTTCAGCTGCAACGATACacGACTGGACTTGAGCAACAACTGTACCCACGCAATGAAGCCTTCACCAATCTGCATCCGACGCATCACTTGG
AATACGTACTCCCAATGCACACGGTCGTACGCCTTCTCAAAATCAAGGAaCGTCGCGTACCCTTCGATGTCATCCACAGTGCACAAGTGTTGCAAGTCAC
GTAGTGTAGCAATGTGGTGGTGGATCAGCTACCACCACGCACAAAGCCCTTCTGATTTGGGTCAaTCAAGTCAGAAGTGATGTCATGTCAGGATAAAACG
CCCCGAGCTCTTGGTTCCTGTTTTCGTAATTCcTCTGTCGTGAATTCAGCTCTGAAATCATGGACTTCACACCTGAAAGCTCCACCTCAAGGCTTGTCAC
ACGCGTTTCAAATCTTCAGTTGAATCACCGGGCATTGGACGAAGACGCGATCTCTGTTCAGATCGTGCTTGTCAATGCTTGAGCCGATGAAGGTGGGGCT
TGGGTCCTTTAGAAGCTTGTTCACAAAAGCTTCCCATGCTTGTTTCAATCGACGAGGTGTTTTCTGCGACAACCGCTTCGAATAAAACTGTTGCTGGCAA
AAACAATCCAAGAAAAACGAATGGGAGgTAGATGAAGGGAACTCTGGGTTGGCTTCTACTGTAGCAATCAGTGGCGCACAATCAAAATCCTTCATATCCT
TGTCAAAAGAAACCTTCCCAcGATTGCCTCtCCCCTGTCCAAGCTTGACATCCTCTGTCGATGTACTGCTCGTCAAGGGTTGAGCGTCGCGCTGACCCGA
GTATTCCATTTCGTCTGCATCCGAAAACGCTATGTCTACcNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN