Description :
From Genome Similarity Track
Location :
Scaffold_66:225- 1312
Sequence
1087 bases(100 bases per row)
CCTGTGGCCTCTTCCCTCACAATCTTGCAGCCTTACTGCTCCTCGTGCGACTGTAACACCCCGAATCGACTTCAATTGATCTGGTCACGCAGGTAATCAT
GCAGTAGTGCTCCACAGTTAAGACCGGCTTCGTCGACCCATGTCGGATTGTCGTAACCTTTCCAGTGGGCCAAGAACTCGCACAGCTTCCGTCCGTAGCG
TGTTCGACGTCCTGTTCACTCGTCCGATATGCGTTCGACTTCGTGTTCACCCTCGTCGAGCTCAGTGTCCGAGCTGTCCCTAGGTAACAACCTACATTGA
CGTCGAGTCGATCTTGATCTTTGGCTATCAATCTCACATTCGGGCGACCTGGGAATCTCCGAACTAGTTTCAGTTTGGACACATGTACCACTGGAAACAC
GTAATAGTCAGATCCAGCGATTTCTAGTCTCACCGCGTGCGAGTCGACAACTCCCGCAACTCCGAAGGGCCCATGGCGCATGTGTGCTCCTCCTATACGC
GATCCAAATACAGCCATTCTTGTGAACCAACCTCGATCTTGTGTGGTCGGGTCGCCTCGTTATACCGATCTGCTCTCTCTTGAATAGCTTCACGGAGACG
TTCATTAACTTGTTCGCGAGCCTTCTGGTAGTGTTACTGGATATGGTAACGCCCCCGGCGGGGTTCTTGATATCGACATCGTGTCGATCCTAGCGGAATC
GCGGCCTCCAACGTAGATCGAGGATCCCATCCATGAACTAAGTAGAACGGCGTGTCACCACGAACACGATCTTGAGCCTTATTGAGTGTGAAAGTCAACT
GTTCCGCGTATTCATCCCAATCCTTCTGGTTTACATCACCCACGTACATCTTGAGAGCACGTGTTAATGTCTGTACCATGCGCCCTGGTGTGCCGTTGGC
TTGAGGGCGATATGCCATAGTCGCTCGCTGCTATTGGCCGACGATCCTGTTGAATGACCTGAAGAAATAGGGCATGAAGCCAGGTTCTCGGTCATGTCTG
ATCGCCTCACTTGCACCAAATCGACGAAACACACATTCTTCGTAGTTTTCTGCGATAGTCTGAGCAGTCCTGGAGGAGCTGGCTCTA