Description :
From Genome Similarity Track
Location :
Scaffold_55:224965- 231327
Sequence
6362 bases(100 bases per row)
TCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCACGTACGACGCAAAGGAAACTACAAAGGCAAGGGAACACACTCGCAAGGCAACCCTACGGCCAGAT
CCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCA
TCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAG
GAAAGTTCAGCAGAACACGGATCATCGGAGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTG
ATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGG
GAAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATCGAGTTTTGGGAGGAGCTCGGTCGACGGAAGAG
AGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTAGCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAAC
AAAACAAGGAAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCTAACACCGTACCTAAACCTAACCCCGCTAGTCGAAGAAACGAGA
AAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAGGCTGGTCAGACAAGGATC
TCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCATGACAGATTGAAGATCCAAGAGAACC
GGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTTTTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCA
GAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGCTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGG
ATCCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCGTCCTCGAACAACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGAC
TTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAGTCCCTGTGAGCGCGAAGGCTCGGGATCCAGTAGGCCCTACG
CGTGATCTGACACAATCCAGCCACGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCTCGGATCCGG
TCTCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACA
GGGTATGAGAGCGACCGTGCCACAAGTGCAAGTGATTCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATGATGAG
TTCGACCCAGATGATCTGGATGGCCCATCCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCATCCATGATCCAGAGGGTACGGATCTCAGCCATA
TCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGG
ATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTT
GCTGCGCAGTTTCCAAACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCACGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATAC
CTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGAATCATTTCATCGAGACGG
TGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCG
CCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCTGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCA
GGAACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGGGTCTGTCTCACTGCATCCAACGATCGAGCGGCGAAGACAGGAGACA
ACTCTCGACCGGGGGATACCGTACCCTGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGCTCACAGTGCGAATC
CCGGAAGCACACTGAATCTGGATGCTGGAAACACCTGGTCTGTGAGAAGTGTGGCAAGAAAGGCCATCCCGGGGATCATTGCTTCCTACGTGTGTCGCGG
GTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCATATCCGCCACTGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCA
GAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGAC
ATCGCTAGATCCAGGTAGCAGGACCCTATATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGAT
GAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGTCGATGGTTTGAGCCTA
CCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCAAACCGGGGAGTC
CCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATTCTACTCCTAGATAGT
GGTGCCGAGGTTTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGACTGTGTTGGGATTGGTGAAGGCG
TGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGACGC
CATCCTCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGAATTCAGCTCATCGGA
CGGCGGCCGTTGTATGGTGCGAAGATGAGCGATCATAAGGGCGGATAAGACAACCTGGATCGAGCCCGGGGAAACCTGGAAGCTGTCAGACCGGTTAAAG
TGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTACCTACCGTAATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAACG
TCAGCGATAAGAGACTATTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATC
CCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCCCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTG
GTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGCGATCCAAGCAATGGAGGGTGGATCCACGACGGGGGACGATC
CCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACAAGTGGATCCAAG
CTTTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGCTTAAATTCGTTAGAGGACCGACTAGATCCA
ACTGGTGGTTTCCCTGATACCAGGGTACCTGATCCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGGGTCGCGGTGTTTGGATCCAATGGTGGATCCTA
CGAAGACGGAAGATGAGCAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGAC
AACAGAGGAGGTCACGATTGATGATATCCAAGTAGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACAT
CTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGA
AGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGT
GGTAATCATCATCAAGAAGAACGGAGTGGATATACGTCTGTGCATTGATTTCCGGCTGGTTAACGGTCTGACTCGACTGATGGTGTATCCGATGCCTCTA
ATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTGGTAACTATGACGGATCGAGCTCGCG
CGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAATCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAA
CGCCCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGAT
CCGGGAACCCAGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTTTAATCCCGGCGACATCCCTACTGGAGGCGTGTACTAAGTGGAATGTCTCTA
TCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGAATTGGAGGCGAATCCTAAGGACCTGTCTTC
ATTAGCCGATTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTT
GCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGG
ATCCACGAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTAAAACAGGAGCTGGATCCACCCCGGGACCAACGGAGAGAGGATCCAGTCTGGATAGA
GACGACGGATCCGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGTCTATCCTC
CGTCATTTCGATCCAGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATC
CAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGACCTCAATTA
CAACCTGCTGGTGGGAAGATCCATCCTGAACCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTAAGACAGTGG
GCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGAGAAGACGAGATCCTGGGAGTCTCGGCCGCGAGCATCACTCCTCGAGCTA
AGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAATGCCGGATCCAGATCCCGATCCGACGGTACAGGCAGACGAGGATCTGTACGTC
CTGTGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTG