Description :
From Genome Similarity Track
Location :
Scaffold_196:22493- 24872
Transcript NameFunction/comments
Phypl_g5086conserved hypothetical protein
Phypl_g5087hypothetical protein PHYSODRAFT_312084

Sequence
2379 bases(100 bases per row)
AGACCTTCGGAGAATGCTGAATATTGGTGGAGGTTAAACTCGAGGCGTTAAGGCTGGCCAGTGAGAGTGGTGCGGCAAGTGGGTGAAAGCGTGCAAACCT
TGGTCAGTCAGAGTGATGAAGGATTGCGGAGACACGACGAACGACGAGGGTAGTGATGACAAACGACAAAACCAGTGAGAGCGGTTTGTTGAGAAGAGGG
ATGGATCGTCATGCGGGTGCGGAGGCATGTAGCGATGGCAGAAAAAAGCTGGAACGCGGGAGATCAATAGAGCGGTGAGGAAAGTCTCCTTGTTGAACCA
ACCACACACGTCTTGTGCCTGTCTTCTGTTGAATTACGAGCGCTTAAGTTGGAACCCCCCAGCAAGTGTTGCCGCTTGACCGTGCTTGGCACCGCTGTCT
GACAGCCAAGTCCGGTTCGACATGTTCAAGCCCAAATTTTATCATTTGTGTCTTGCAGGCCACAAGTTGTGGCGCAGCGAGGAAAGGCAACAGATCCTTC
CTTGCCCAGCTTATCAAAAACGACCAACTTCTTTCGCGATCAAAAGATGCCTCGCACGAAACCTGCCATTCCCGACCCAGCCTTCGAGCTACGCCGTGTC
GCACCTGATTGCACTTACACTGCGGAATTCTACCTGGGCACCGATGTTCGACATCTATCGAGGACAGTGTACATCGCTTGAGCTTTGTGCTCGGAGCTTT
CCGCGGATGCAGCCACGTATTTCCGGCCACATATTATTCACACCGGAGCTCCTCCTAGCTGAACCGAACTAAGCCTGGGTGTTAAACGTATGAGAATTCT
CATGCCAAGCCCCGATACAAAAGCGTTGAGGGGTGCAGCGGCGTCCAGAGCAAAGCGTTTCGTGGCCACTGGACCCTTCAACACCGCAGGTGTTGAGTGC
CCTTTAACACTATGCTTCAGTATGCGTCATTAAAGCGGAACACAATCATTCCATGCATGCGGCGTTTCGGCATCCTCTGCTGCAAAACTCCTTTCAGCCT
CCACACAGCACGCGACCGGCGGCAAGCGCGGTAAGACTCTCGCTTTAGCGCCTGGGACGCCGCTGGATCCGACTAAGAAgcgcacgagcacgaggaccAA
GGCGCTTCCCTCGTCTGCCGAGCACGTGCGCACGCAGAacacaagttgaagtggccatCAATCTCCCCCTCTCTCCGGACAAGGGACCTGCCTACCCACC
TGGTCCATGGAGCTCGCGCCCGTGGCCTCCCCGTTCAGCGGGCGGACGAGCGCTGGCCGAGAGGGCTCCAACGCCAAGCGGAAACTCGAGAGCGTGCACT
CGTTCTTCTCgcactcggcgtcgtcgtcgccctcgggCTCTCCGACCGCCGCGTCCAACAGCTACAAGCCTTTTCGCGCCAACGCAGACGCACTCCCGCC
GCTGGATTCGCACGCCAAGGTGCGGCGTCGCGCCACCGCGGGGCCTCCGTCGCTGACGCGCTGCTACTCGGACGGGAAAATGTAAAAATCCTGGACCCTC
TCTCTTTTTTTCTCTTTCGGATTGCTCAGTCGCTGTTGAGCTAACGATCAATGATGTtgtctgttgctgcttgctcgaCTAGCTCAAAGGCGTTCGGAGA
GTTGCTGACTGCAGAAGAATCGGGTGACAGACAGAGACTGCCCTTGTCCAAGGTCTGCCCTGAGTCGCCTGCCCTGACGTTGCAGAACTCGAcgtcgcag
aagaagagcatttcgccacgagctggcgtGTGTCCGTCCCCCGGACTGCACCGCAATCCGTTCCTGGATGACGAGGCGTGGCCATTGTGCGTCTCGAGAG
GTAAAGCAGAGAGAGCTGTTCATCAAGCGGACAACCGGAAAATCCAGCCCTAGATCATATTGGGAGACTGGAATCCGGTGCCGATCGTGCATTTCGCTGA
CGGACATGTGCTGTTGCTTTGCCGTTTATGCCAATTTGCTCAGGTCCGACGTCGACATCACCGGCATTTGTCACCAAGagctacaacaacaacacgaCAC
CTCCGCGGCAGTCGGGTGACAGCTGTGTGATGTTTACTCCACCGACGCCGAACAAGCGCGTTTGCAGCCAGCAGGGCTTCACGCAGAGCAAGGCGGGCGC
GACTGCTTCGGCGGGTAACTGGACGCCTTCTCTTACACAGGCGAGAAAGCGCTCTCTGGTGGCATCTGATGCAGCTCACTTCGCTAGCGCGTCTCCATCA
GACAAGCGAGCGTCATTGTCCATTGAGATGAATCTTGAGAGTCGAAGCAATGCAGTCGCCGGGGCGCTGTCCTCATgttcgtcggcttcgtcgacCCCAT
CGGTCACTGTGCTCCCCCGAGGGAGCGTGAGCGCACCGAAGAGGATGTACCCGCCCCAGCAACGCCGCAGTCGGAACCC