Description :
From Genome Similarity Track
Location :
scaffold_425:22492- 25324
Transcript NameFunction/comments
g8260.t1hypothetical protein

Sequence
2832 bases(100 bases per row)
AAGCAAGCAGGCGAGATCAGAGTCGCTATCGGATACCTGTACTGACGCGAAGGCAGAAACCGTCACGACACCTGTGGCTTCTTCGTCTACGACAACCACA
CCCGACGATCGATCAAAGACTGTAAATGAGACTGAGGAGCAGCGAAGAAAGCGAGAGTTCGATGAGACCGTTAAACGTGAGGCTGAGAAGCTCCGAGCCG
CTGCAAAGCTCTCCGCTCAGAAGCGGCTCGAAGAAGCCAAAGCAAGCAAGGCGTTCTGGGCGAAGCGTGATCAGCTGAAAGCGAAATTGCGGGCTTCGTA
TGCTGAGGAGAAGCGCAAAAGTGCTCATACGCCTGTGGCTTTGTCTGAAGCGCCTGCCTCTGATCAGATCTCCCCACCTACTTCCGAAATATCGACTGCT
GCTGAAAGCAACCATTCCGCGTCAGATACTAAGCGACCGATTTCTCCAGCCTTGGTGGACGACACCCGGCCACAGGATGCAGTTGAGATGATCAGAGAAG
AAGCCTTAGACAACGATTTTATGCGGTCGATGGCTCGACATCAAGAAGTGGAAAGCATCTCCGATGTCTCGTCCGCCTTCGAAAGCTCGACACTCGAGTC
AAAGGCCCCCCGATCAACGTATTCCGTCGTGGAGGACAAGCTGCAAGCAGAGCGGTCAATGCCTCGTCGGGTGGCAGATAAACCGACTGCAAAGTCCATG
CCACTAGCTGCTGGAAAGACAACGGACCTTGATCAGTTGTCGACATCAAGCAAGGTCGCTAACAAATCGGACCCAGTGGGTCACGCTGTTGAGTTTCTCC
CCACTCGTGATCGATCAGACTCGCTTTCCTCTACAGTGTCGTCGATTCCTGAGCCATCGGTTGTGGAGAATGCCTTGAAGTCCGGTGCTGCTACAGCTGC
AAGTACCAAGCGGAAGCCCATCGCGAATCTTGTCAGTGGCTTGCACTCTTTTACGACTTTGCTTGAAAAAGAGAACCCTCAAGAAAGCAGCAACGGCCGC
AGTGCACCCGTGGTGAATGCTTTGAAACTTGCAGAACGGTCACGAGTAGCTGAGGAGAAGAAGAGGCTAGAGAAGGAGAAACGAAAGGCGATTTTGAAGC
AGAAGATGGAGGAGCACAAGAAGGCTGCTGCGCTAAAGGAAAAGGCTGAGAAAGACGCCCAGGCGAAGCGAGAGCAAGAGCGACTGAACGAGCGGAAGAA
ACGTGAGGCGGAACTTGCGAGACGACGCCAGCAGAAGTTAAAGGAGATGCGTGCAGGGCTGGAGAAGAAGCGCGCGATACTTGCAGCAGAAAAGAAATCC
AAGATCGCAGCTATGGCATCGAAATCCACTGCCACTTCGTCACAGCACAAACATCGCGGGTTGGCTAATGCATCCGACACCTCTCAGCCTACAGGGAAGC
TCATGCCGAAACCAGTGCAGAAACCCACGTCAAAGGCACCACCGGCACTTGCATCCACCAAGTCAGCGCCTGTATCGAAACCAGCGGTAAAACCTTTGGC
GAAGACTATGTCTAGACCTCCGATGTCTCCTGCACCGTCCAAGCAAGCCCCCAAGAGCCATTCGCCTGAGATCGTGAATTATGAGATGTCGGACAATGCG
GAGTCTTCTGATGGAGATAGCAGTGACTCGGACTCGGGACGTCATGGGAAGAAGAAGGTGCCGAGGTGGGCTCAGAGGGACCATCTCAACAAGATTCTAC
ACGCGCAGTTTGGTAAAAACGCCACAAATCCGTCGCCTGCAATCTTCCAGGACTCCGTGGATACGTGCAACTTGGAGGCCATTTTCGAGACGACCGACAT
CCGGAAGAAGAAGAAGTTTGCGAGGCGGACAAGCAGCGGTAACTGGTTAGCTGATCGCCCCACGGCGCGCGACAAAGCTTTGTATCAACGTGACATGGGC
TACGACCGGTGAGAAGGATCAGGTGAAGATTGCGATGGTAACTGTACTCTGGTCAATTTTATACTACTATTTACTCAAACAAGCTGAACGACAAGCTCCT
GCGTAAGGTAAGGGGTATCTGCTATTGTTTCACGCTGCTTTCAGGGTCGAGACGCTACGGGAACTGGCCAGAGCTGAACGTTTCTGCTCCTTCTTGGAAT
TTGGGGCGGGGAGAGCCACGTCAACCGCTTTTCGAAATGCTGCTGCGTCTCCTTTGTAGTTCCCACTCCGAGTGAAAAAATCCTCACTTGTAGCGAAACT
GCTGGATCGACGGGGTTTCGTGTGCATTGATGAGAAGAGGGAGTTCCCGGAAGCAACTGTCGATGAGGAGCTGCAGAAGCCGTCAAAGGACCCACATGCA
GATGATTCTGCAGTCGAAGCGAAGATCTTGAAATCTCCTGACGCGTAAATGCGCAGTATTGTTTCTTCCTGTGCTAACAGATCCATGACGTGGTCTGCAA
GATTCTCCAGTGTAACTTCCATCTTGGAAGCGGCAGCAGCAGTGCGAGCACGAGTGTCGAGCGCTACGATGCACCCGAGAGCTGGACCTGCCGTCTCACG
AACATCAAACAATGGAGACGCCCCGAAGAACTGAAACGTGGATGGATCGGAGGAGCAAGTGGAGGGCGTCGAACTGGACGAGTCAGGCACGGTAAACGCG
TTCTGAGTGCCGAGTGCTCGGCTGCAGATGGAGAGGAACGTGGGGTCGTGGAGAACGCGAGGGTGGAGTCCTTTGTGCGCGATGACCCAGAGGTGCTGGT
CCTGGACAAGAACGATAGCTCCACCCACGCAATCGAGGAAGTCAACGAGCAGGGAGCAGACGGAGTGGAGTTTCTGGTTACGGTACTGGCTGATAACGAC
GTCAAACTCTCGTGAACTTTGTGGGGGCGAAG