Description :
From Genome Similarity Track
Location :
Scaffold_1919:2249- 3494
Sequence
1245 bases(100 bases per row)
TACCTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGTATATAAACTCTCAGTGAACGGCAGTTCACAGGTAAAGAGAGCGA
AGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGGGTTTAATACAAACTATTAGTTACCTATAGAAATGCAATGTCA
TTTAACCAATGGTTGGCTTTGAACGACCTTGGTACCTTGTACCAAATATCCCGGAGTATGACGTGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATG
TAACCAGGGTACACTTAGGGCTACGTACCCCGTTACATCCTTTCCCACTTAGGTTCGGGTTTACCGACCAATCAGAATGAAGAGGTGTTCGTCACAAACT
CTCATTCTCAAAGTCGAAACCCATCGTCTTGGCTGCGCGAGCGCGGCGGAAGGCTCACTTCACAGTTAGAGCCTCGAGCAGCAACCTGTGCGCTCTTCGT
CTAGGTCTCCCACTTCGACCGTTTATCATGCCTCGTGGCACTGCAAAGAGCGGTGCTAAGACACGCTCCAAGGCTGCTGCCGGTAAGGCACAAGCCAAGA
GCACTAAGCCTCACGGCAAAGGCTCTGCACTCAAGGAGGCTACTCAGGTGGCCTCCGAGGCGATCGGTTTCTCGGGTGACGCGGCTGTGGACAAGCGCGC
AAGCAAGCGCCGCAGCCCGTCGCCCTCATCTTCAGACAATCGTCCGAACCCTCGGTTCATAGAACGTGAGTTCAACTCTGGCAGTGAGGAAGATGCCGAG
TCCGAGAGCACGACACGATGCTCTTGCGGGCTCTGTGGGAGAGACACAGACCCAGTGCCCAGTGAGCACAAAGATGACAGCGTGCAATCGCTCGCTAGTG
ATCAAGGTGATCACAGTCCCACGACCTCTGTGCGCTCTGAGAGTCCGGCCGTCAAGGCTAAGGGCGCTCCCAAAGCCGGTGGCGATGAGGAAGAGAATCC
TCGCAAACGTCTCTCGCTTGCCGAGGGTCTTGTGCGTGCTAAGGCCTCTAAAGCCGAAGGCACCAAGCCCTCAAAGAAGCGTACAGCCTCTAAGTCTCCA
CTCGGCGAGGAGAAGGAGACTCGTCGCTCCTATCGGAGTATCTTCGACTCCTCGGATGAAGAGGAGGAGAAGGAGGAAGAAGAGGAAGAGGAGGGTGCTA
TCGTTGAGCCCCGGGAGGTCTCGAATGACCTCGACCAGCAGCAGG