Description :
From Genome Similarity Track
Location :
Scaffold_316:22487- 24691
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_316-snap-gene-0.20Zinc (Zn2 )-Iron (Fe2 ) Permease (ZIP) Family
Pytul_var.sporangiiferummaker-pug3_contig_316-snap-gene-0.15GTP-binding protein ypt7

Sequence
2204 bases(100 bases per row)
ATTGCAGTGCTTGGGAGGATTTGCCAAAGCGGACTGTAAGACTGCATAGACAGCTTGGATATTGGGTAATGCAGGGAGTGTGTCACGTCCACTGCGTCAT
CGTAAGTGGATACACTCCGAGTAAGAGCTATGTTGGCAAGCATTGACACCATTCACTTGTTTCCTTTATTACGACGCACTTCATGATACAAACAAGAGCC
TCGACCTTCACACACACACACACACACACGCACGCACACTGTGCACCAATTCGATCATCAAGCCCTGCGGCAACAGTGGCGGTGGTGCAGTTTACGCCCA
GATGGACAAGGCCCCCATGGCGCAGTACCCGGCCACCAATGCCGCGCATTTCTGACTCAGGTGCTTGTTGTTCTGGAATTCCTGCGGGATGACCTCCATG
ACGGCGACAAATAGGAACGTACCGCCTGCGAGCGCCGAACAGATCCCGCTGCCGATACTCTCCTCAGTCGAGTCCATGAGCAACGAGCCCAGGAAGATGC
CCAGTGGCGACATGACGGAGAAGATACCGATGGATGTGGCCACGCGGTGAAACGGGACCTGGTGGTGCTGCAATTCCAACGTGAGCGCAAACGNNNNNNN
NNNNCAGCAAGCGACTTGTGCGCGAGCACTGCAATCAGGATGTCCCATGCAGCATGGCTCGATGCGCCGATGCCCATCCCTTCCATGAGCGAATGGAAAG
ACAACGCGACAAACACGACGANNNNNNNNNNNNNNNNNCGGGCTTCGCGTCCATGATCCCGTGGATGTGCGCATGCGTGACTTCCATGCCGGCGCAGAGA
GCATCGTCATCGGTGTCCATCGCCTTGCTGCCATGATGATGATGCTGATGATGTAGTGCGTGATGCGTCGTAGAATTTTTCAGTGTGCTGCCGTAGGAAG
GCGCAACGTACGATAGACCGTGACTGTGGCCACCGCTTTCAAGATCGTGGTTGTGGTGCGTGTGACTAACAAGATCTGTCTCATCTGGATGGATTCTTGT
AGAGGGTGACGCGATCTCTGTCTCATCCGACGATGACGAAGCGTGGTGGTGGTGGTGATGGTGCGTAGGCAGCACGTCTGGCTGACGGTGGTGGCTGTGG
TCGATCGTGGAGTTTACGACCAGCGACGTGAGCTCATGACCGTGTTGCTGCTGGAGCCCCACTTTGCTGTTCTCGTCGCCGAACGTGCGCTGCAGCGAGT
GTGCAAACAGTTCGAGAATCAGCACAAACAGGAAGCCCGTGCCAAAGAAGAAGTTCGCCCACTTAAAGCATCCGTCTTCCGATTCACAGAGCCATGTCGA
GAGCGCTTCGTTCTCCTGGGCATCAGGCAGCAAATGCAATACGGCGCCTGAGAGGAAGATGCCACCGGCAAACATGTTGAGCACGCTCGTGAGCGAGCCT
TTGCCGTGGTGCTGATCACGGAGCATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGATCAGCGCCGCCGAGAAAAGCTTGAAACCCGCC
ACAGATTCGAGCATGGTTCTTGCTTGGACAAGTCTTCAGTGCCTTGGCGAAATATATAATGCCAGAGAGCGCAAATTGCAAAGTGAACGCGAGCCATGAA
AACCAACAAGATACGCTTTTCTATTTTGGAGGCTGCGGGCTTTCTCGTATTTTTGTCCGACGGCGGATAGCGACACACGCACGTACCCAACGGTTTTAAT
TGGGTTTGATAGCGAGCGCCGGTGATTCGCTGCTGGACACGCGTTGATCTCGATGGGAGGCACAGGTGCGACAGACTCGACTTGAGCTCATAGGCTGCCG
GTGTCTGGCAATGGATTGCGTGTATCCCTTTTAATCAAGTTCGCTCAGCGACTCCCAACTTTGTGATGACGATACAACTTTGCACACAGTGAGCCGCCGT
CGGAGCAGCAGATCCTCTGGTCCGACGACGACGACCGACAGAATGGAGAAGCTCAAGATCGTGGTGCTTGGAGCCAGCGGCGTCGGAAAGACCACGTTGT
TTCAGCGGCTCATGGGCAGTGTGGTGACAGCCAAGGGCGACAAAGAGGAAGGAGGGGATGCGACGATAACCTCAACTTATGCGCCTTCGACGACAGGTAC
ACCGTCGGCGATATCTCATTGTAGCTCAGAGGCTGGACATGATTCGTCGTCGGAGTGGTATACTGACAACGGATTAATTTGGTTTCTACTGATGCGGTAT
TATT