Description :
From Genome Similarity Track
Location :
Scaffold_44:224847- 232640
Sequence
7793 bases(100 bases per row)
ACTTCACAGTGTCGGTTTGTAGTATTATGCGCTACGTCGTCAGATGCGTCTGTAGTTCTGTACATACCCTCGTCGGCTGACGCGGTCGTGCTATACATGT
CGGCGTCATCATCTGCGGCAAAAAGGATTTGTACGCCTGAATCGCAAGCCACGTCATCATACTCCAAGACCTCGGTAACATCGCTGTCATTGCTGGGGGA
GGCCCCAGCCGACTGCATGTGAGCTTGCACGTGGGTTTCACAATGGCTTCAGAGGGTGCAAGTTGTGGTGGCGCCGGCGGACTTGGTGGTACCACTAGCG
CGACTGGTGGTGCTGCAGTTGGGCTTGTTGGTGCAGGTCGTGGTGAAGCCAGCGCCCGCGGACGTGGCGGATATATTCATGAGAGGCAAGTGGGATATAA
AAAAGAATCATAGTTTCTTACGGTATATAAAGAGTGGATGGAGCGTTGCCTTCCAGCTAACATGAGCTTCTATGTGATGATCGAGCTCGCAGCACTTGCA
GCATGGCTCTGTGCAAGATGAACGATGACTCGGGCAGAAGAGCGACGTTGCAACTATCATCCGTGCCTCTGACATTGCATGTAGCTCTCGTAAAACAATC
AGCTTAGCATCTTCTTCAAAGAGGAATATCTTATCAAAGACAATAGTGGCTTCACAAATGTGAGGAAGCCGTGACATCGAAACATCTCTAACATCCACTT
GTTTGAGCAGTATCTTCCTGAGCCATGGATATTGCTTGAGCTGCTGCTGTATACAACGATCACCTAAAGAGACGTGGTCTCGTCGAAGCTCGACCCCGAT
GCACGCTCTGACGTTCCTCGTAAGTGCTACTTGCGCAAGCACGTTGCCAACACCGGCCTCAACATCAACAAATATGCCCGCTATATCGAGTGGACCAGCG
GCTGCAAGTAGGAGAGTAGCCCCAGACGGTAGCACCTAACCCGCGTTGTCATAGGTGCGGCCAGCAGGTTGGCAAACGCCATGAGCACTGATACTTCCAA
CAATTTAATCCACCGCTCCAGCAGCTTGGACGTCGTCTAGATTATCTCTACGGCATCCGAAATCGGCTACTTCGTCACCAAAAAGCCCAGGTTAGTATTG
TCAACGTCAATTTTTACACCGACAATCCGAGACGCATCCGATGGGTTTTTCGCTCTAGGCGCCGGTGGATGACGGCACCCCCCAACGTTACGCGCCATAC
AGTCACCATTAGCTCCTGCATTCTGATCAGAGCCCTTGCTCCTTTCTGTCTGGCATCTCTCCGCCACTGGCAGTACTCTCATGTGTACCGTCACCTTAGC
AACAAATGCGACGTCATTCTCACAAACGGCACAAACGTCTCCTCAAAGCAGACGAACCTGGCGCGTGGTGATCATCGCAGAGACCTTTGCACTCGACGTA
GTAGCTGGAGGTCGGCAGACTGAGAAGACGTCCTGAAGACATGCCGCTAAGCAACACATGGTGAGAGGTCGCTGATCGCCTTCCCAAACGTCCTTTTGAG
GCTGGCCAGCCGAAGCTGCAGTTGGCGGCAGGCCGCTTGGTCTTCGGCGGTCCACGTAGTCCCATGTGATGCGCAAGCCCTCCTTCTCGAGCTGGAGGAC
GATTTGCACCCGCAGCTTGTCTTCTGTGTCTGTGAAGCTAGTGCACATTAGTCTGGAGAGTACTAAAGCAGAATGGGAGGACGTATATGTGCATTTGTCT
TACCTTTTGTATGGTCTGGTGACTGGCTGTCGGGCGATTGACCTCTAGATTAATGACACGGCCGAGTAGAAAGGGCCGATCAACATCGTTGGAGCAACGA
AATACGATGCGGTGATCAGACGACCAAAAATTACCCACACCCTCATTGCATTCACTGCTGTGATCGGTAGTAATGATACACGGTAGGCAGAGCTAGGGCA
ATTTGTTTTGCCCTTTTAGAGGGTCATTTCCCACCTTGTTTTGAAAAAGGGTTTTAAGGGCGAAAATCGCACTCTCACACCGCGATAAGGTTAATACGTG
CAGTATTAAATCGAAGCAATATGATTATTAACAATAATTTAATACTGCAAGTATTTGACTTGACCTTTGTAAGCAAATAGAGCTATCGTAGTAGACCCCT
CGGCGCATAAAAACATGCATACAAATGAGATGAGATAGGAAAAGGCAGACGTGGAATTATTTTATCTGCGCGTCTTCAAACACGCAAAAAAAAGAATCAA
TTTACAGAAGATCGATGGGATTTGCTTGGATATCCATCTCGTGCGCTCAATTAATTATACAGTATCGATAGTTTGTGGTAGCTTCGCTTGATCGATTTGC
TTTTTTTCTGGCCTCGAAATATAAAACGATTTCATTTTTTTAAAAATCGACGGTGAGAACGACGAACGAATTGAAAAGCACAATATTGAACTTTCGAAGC
TCAGTTGATTTTAGTTTGAGTTTCAGAGCGGTTTGTTTTCCGTGTGCTGGTAGCGTAAGGGGTGCGCGCAGCGGGTGCGTGAGGCGGACAAAGTTGAGGA
AACCGTGTTTTCCATGAAGGAGGGCACCGAATTTGCGTATATTCTGCGATCAAACATCAGAAAACGGACATATCCCCTTGTCCAATCACCAGCCACCCCT
TGCTTTCTGGGGTTCATCTGGAGCTCATCGTCGCAAACTCCGCGCCATGAGCATCGCCTTCGCTCACGCATCCATAAGCAAGCTCGATGACGGCTATATT
TTACCCTCCCACCATCCCCGAAGATTAATGATTTAATATATATTTTTAAAATAACAAAACTTTATAAATTTTAATATTATAACATCCGAAGGGGATGTCA
TTCGGCACCTTGCCTATCAAGGCAGGAACCTTTACGCCTTTGGCCTGTAGCCAAATTAATCACACGTGCCTCCACGGGAATAATCTTAATTTATGTTGCT
CAAATACTGATTGATCTGTTGGTACTACATTTGTATGAAAATCTATTGCTCTGGTCTGAACGCTTGCTGGAAGGCTATGAATAGCTGTTGCCCTAACGAC
TAACATAACTTTAGTGATGACGGTCTGCTTTTTTTAGTGTCATTGGTCGGAAACAAGTCCGTTTCATAATAAGTCCAACTGCAGCGCCAAGTCCGACACC
AACATCGCCTGAGCCAACGCCGGCAGCATCATCACCAAGGTCGCGCGCCAGCTTGTCCTAGTCACAGCTATATGCGTCATTGCCCCTAGGTCGTCCTGTA
TCACAGCCACTACTTCCACGCACAGTCTCTCGCTCCGCGTCCCTGCTTATTCTGCGATTAGTCCTTTCACGCTCTCGCGCAGCTTTGCTGGCATTCCCGC
CTGACGCACGGTAAGCGGCGTGGCACTGCCGCTCGGACCAAACGCGTTATGGCCTTGAGCATCACCTTCACTGAGCCCGCCGCCACCGAGCCCGTAACCA
ATCTGCCGAGCAGTCGCAAGCCGTGGTGTTTGTGGTCTCATCTCGCAGCTTCACAAAATCACAGTGACGACGTACATTTCCTTTATCGGTAAACAGACCA
TTAGGAAAGTAGAACGGGTGAAATTTATTCCAGCATGTAGATGTTGTCGACGGACACATCCATGGTTTCGCGGGGTGGTCATGTACAACCCGGCATAAAC
ACACACCGTATGTTAGGTGACCTCGGTCGGACAGCGCCCCTCCCATCTACACACAATACAGCTCCGGCGTTTTCGGCTCTTCTCAGCGTGAATTTGTCTT
AAAGATGCCGATGTGAACGCCGTTGTTGGCAGCACTGCAGTCTTGCTGGGTTGTGTCCGAGATGAAGGTGTGCCAACTTGCCCCACATCTCCGCTGTCGA
GCATTCCACAACTATATAGCACTCTACCGCCACTAGGTGCATTCCTCCACTGCCCGTTCAAAAGATCACCGACCAGCTCCATCAGGAACGGTCTGTGGGG
GTCACGAGTCGCTGGGTCCGTCTTCACCAGTCGCCACGTAAGATATGCGTTTGACCGTGCAACGTCAATAAGCGCGAGGGTCAGCTTCTTGTCTCATCGT
TTGTACAAATGGTCATCCGCAGTAGAGAATCGTTCTCGAATTTGGTCGAGGCGATCAACATTCTGCACATTTGTGTTGAACTGGGCAACACATTCTGGGG
CTAGATATAACTGCTTCTCCCTGACAGCCATTCGAGCCACACAGGTGATATTTGAAGAATCCGCATTGGACACCAGGTTGACCACGTTTCCGCCACACCA
TGCCGCCGCTAGCATGCTGTGGTCGTGCGAGACGGCTTGACGATAATTCCACGGTTGCAGTCAGAAGGTCGGGATATCAAATTGTAATGTGTTCGCAAAA
TTTGGGCGAGAAGGATTTGGCGTCAAAGCGCTTTACAAAGTTTCACTTGTCCATAAATAGCGTAAGATATATGCACCAGTTGACCGCAACCCACGGAACC
GTACAAAACCAGCGTCAAGGTTCTGCCTCGCTTCCAGCTAGCTACCCCTAAGTAATTGCTAAAGATGCATCTTGAGCATTATGTAGCAGCCTCCGTCTGA
TCGCGGCCGTCTATAGGCTAACCAAGGCTGCATTAGCTCCGTAGACTTGTTATTCCCACCGCTTATTTGATGTTGGGCGCTAACACGACACCGAGCGCCG
CGGCGAGCATCATCCACTGATCAACGCCAACGCGTCATCATTCAGAAACTGGTCGCTGGGGTAAATATCTTCGTATTTGTCGGCGTTATGTTACCGGGAA
GGTACGTTGTACCAGTTTGTTTTGTCCAGTCACGATAGTTGTGGTCGCCATCGCCTCAATCGTTCCTAATGTTCGCTTATTAGCCAATCAAAAAAAACTG
TAAAGGGCGGTTTTTTCTCCCTTTTAGGTCGCAGGCTAACTATTCCAACTGCATGTCTCTATCTACAAAATTCCCTTAGTTATCACGTACGATTTGCTAT
GACATTTAGGAGGGTTTCAATCAATCAGGGACCGAGCGGGAAAGACCTCCGTGCATCCGTCATTCTTCACAGCGGCGCACAAACTAGAGGTCCTACACCC
CTTGGAAAGGGGTGGAGACATCAAGCGATCGATGAGTAATTTGTATACTGATTTTACTCAGTCTAAATATGACAGCCGCCGTACACTTATTCATTGTTGG
CGCCGAACACGGCCCAAACTCGAAAAAAGAAAAAGTCACGAGCGAAAGGTGAGGGCACGGTGCTGCCAAAAGATAAGGAGCTTTGTTTGGTACGCTGTAT
AGAAGATTTGAGGGAGGAATGGGTTTGATTGAACGTGGTGGTGGAGAACACGACGATATCGAACCTGAAAGTACGAGGATGCAAATGACATCGTGAATAA
AAACCTTTTATCGGGGGATTTAGACATGGAGATAGGAGAATTTACGCTGTTATTAAAGTTTGGACGATGATTGTGACGACATGTTCCGAACCGCTGCAGA
TAATAATCTACAACAATAGATTTTTAAACACTTTGGATAGACCGTACATGCAATTTCTGGTTACGTGCGAACACCTTTCTGAATGTCATAGCTGAGAGAA
TTCGTTACAGCTAAAAGGGCGAAAAAATCGCCCTTTTACCTTGAGACGCACCAATGATCCCCCATCTAATCCACTTGCGTCGAGCAGCAGAGCGAGCACT
CAGCCGGTCGTCACTTGCGAGCGATCTCGTGCCATAAGCTGTCGGCTCCGAGCGTGATGCCATTTAGTCTCACTCCCCGCTTGTCAATTCGCTGGCGAAA
TGGATACTGGCTGCTGGAAGATCGCCCAGCTTTAACCTTATGTTGCGGTAAAGTTGCGTATCAGGGCTTCTGTTGCACTACCTGATTCAAACCAGTGGCG
GCTTCAACCGCCATCAATGTCCTTCTCGGTCAATGAGTTGATTCTTGATTTATAGTATGTCCCGCCACTTTTTCGACTTCATCAGATAGATCGGGTAGTT
CTTGTGCTTATAGGCCGTTTCGCCAAGGTCATCTAAGCCCAAGTAGGTGTGTAACTGTTTCGGATTCATCTTGTTAAAAAGGTACTTGATCCAATCCGTA
AATCGGCGAAAAATTCGTTCTTCATCACCTTCTCAGTCCTCAACATTGCTAACTCTCATGTGGTCGGTTCTTAGGGATCGCTTGCCAAGGACGTTTTGTT
CTCCATCGAGAACTGGGTACATAATATTCGCTGCTGTTTGCCTCGTTTCAGCCGCAGGCATCGTCAAGGCAGGGATGTGTAAAAACACAATGGCCGCTGC
TAGCAGCATCAGGTAGTCGGTCCGCATCGACAATAGGTGCTCCTAGTGGTTGGTTTTGTTTGGTAGAAGGAAAAATGCGAAGTGAGAAATTGCATGGGTG
AAGAACAGTGTATGATAGTACAGTAAACAGGTTCAGAGTTTACGCCTGAGCTAAACACGAGCTGTGGATTACGGTATCGTTTAAACGTAATACAGAAGTC
CCTCAAAGTAAGCGTCACCTACTTACGTAATACCCCGCCATATCTGCTACGGTACATACAGGTTCAACTGGCCAATCACAAAAATGCACTGATTTTGGAT
AAACTGCAGTCGGCGGGAAAGATCTCCATCATTTTCAGACCGGTCCGGTCTCTTCGCTAACTAAACCATTGAAAGACTGAGGTAACTCATGCTCCCGCTT
CGTACGCCTCCCTCCATGCTCACTATCACTCTTCCAAGCGACCATGACCGCCAGCCCCATGCCGCGCCGGATCCGCCTTAATATGGAGCAGAAGATCGCT
ATGTGAAACAATTGGCGGGGCCCCGGGGTCCCATCCGGACCCCGGGGCTCTCATAAGTAAAACTGTTTCATGTGCAAGTATGCGAAGGATATGCGCGCCA
AAGGCAAACTGTCCAACACAGCTCGCAGCGTGGCCAACCCGTGCGTTCAAGCTGGAAAAATCTCTTTCACGCGATGCCGCTCGCAATGTTATCGCTGGGG
AGTCTAAGTGGGCCGCTATAGAGCCCTGTCAGCTAGAGCGCAAGCAGCTCGTCAGCCCCCAAATCCAGGAGACGGACGCTCGCATTATGAAGGTCTTTAA
GGCAATGGACGGCAAGGTGGAGGCTATCACAGGCAAGGTAATAAAGGCTATTGCTCTTCGCGTGAACGTGTATGGCGAGAACACCACGTTGAAGCTCTCT
AAGGGCTGGCTGTATAGATTGCAAGAGCGTCACGGAATCTCCAAGAAGCGGAAGCACGGCGAAGCTGCGTCAGTTGACCAAGAGGCAGCTGAAGCCGGAC
GTGTGAAACTACGAAAGCTGACGGACTCGTACGCCCGGTCCGAGATCTGCAACATGGATGAGACCTCGTTCTTCTTTCGGAGCGAGGCTAAGTACACTCT
CACGCAGAGGAAGGTGTTCTCTGGACGCAAAGACCCCAAACATCGGCTGACACTGGCTCTAGATATCTACACCGCTCTTTGTTGGAGTAAGGTGGCCTAC
GACGAGATCTCACCCAAAACCATTCAGAACTGCTAGCGACACGCAGGCATTCTGTGACAGGAGCAAGATCGCCTCGCTTCTTAACTAAATATCAGTACTT
TTTAAACATCTGTTTATCACCCTCTAAGATCGTGTCTCGGTCCCCCTACGCTTACTTTGAGGGACTTCTGTACTGTACAACGTCCCAGGATTAGCTTACA
TCGTGTACCGGAATGTACGGTATTTTTGCAACCGATCAAGTTTTTGCAACCAGTGGTCCGTAAAAAGTCTGCAAAATTATTGTGGGTTCTACTCAAAATT
TTCAGGGCCGATTGACATGCCTCCAGGCGCAAAAAATCGCTCCACTACCAAACAACATAAAAAATGACAGATGAGAGTGGTTATCTCGCTTTA