Description :
From Genome Similarity Track
Location :
Scaffold_202:2248- 9341
Transcript NameFunction/comments
Phymu_g6631hypothetical protein PHYSODRAFT_313130
Phymu_g6632conserved hypothetical protein
Phymu_g6633hypothetical protein

Sequence
7093 bases(100 bases per row)
GTCCCTTGCAATACCAAACAGCGAGACGCTCAAACCGATCACGTTGTGCCGATGCAAAGCCCCAAGAAGCTCTGCAAACGATTGGCACCATGTGCGCGTG
GCCCAATTGGCTTTGTGTGAACTGAATAGTTGCGGTGTGCGAAGCTACGCCATGGGAACGCCGCGCTTTCGTGCTATGGTGCTCGCACTGCGTATTAAAA
CAGCGGGGCTCACTGTGAGCTGCGGTAAGATAGCCGTCATCCATCAGGTGATACCAAAGCTGCCGTTTTGCGTGGATATCTTTGCAGTTCGGACGTGTCA
CTGCTAGGGCAACACGCAATTTCGACCGTCTGCTGTTGCCCCAACAACCGAACGCTGCAATGTCACATTCGTGACAACGTAGGAGGCTGGAATCTATGCG
AGTTCCTCTCGACACACCGCAAAACGCGATCCAACCTTACATGTGTACCTGTATCTCGTAATGCACAATATCGACTTTACACCTTTCTGGAACGTATCAG
AGCATTGCGCCGAtgcaaataaaaaaaatccGTCGAGATTGAAAAAATGCTTTTCATGAAGTATACCGTACCTTGTACTTGTATACACGTTCATTGTTTT
TGTGAGCCACAAAAAGCGTTAACCCAAAAAAACCTTAATTGCCCTGAGCCGGGCGAGGGATTGTAATAGGGACATTCAGACCTTTGACTAGAGATTTATT
GGAAACAAAATTCTTATTTTCACCAATCACCTTTAGCCGTGAGCTGGGCGCACCCCATCATTTAACTAATCACAGCTACGCATTTGAGATCCATCCAATA
CGCAACATGTCGGAGACGCAGcctgcagcatctccagccCCGTCCGAGGACACGGAGGCCTGGATGAAGACCGGCACTCAATCACTTGCCGGTGGAGGCC
AGGATGCTGCCTCAAccagcgacgagaaggacgacaaggacgaggacaacCCTTTCTCGCAGTACTACggaatgctgctgcaccagcagaaTATGCTGCA
GGACCACGTGCGCACCGGCACCTACGAGCGCGCAATGCTCTCCAATCCGTCGGATTTTAAGGACAAAGTGGTGCTAGATGTGGGCACGGGATCGGGCATC
ctggccttcttcgctgtcaaGGCGGGTGCTCGTAAAGTGTACGCCGTTGAGCTGAGCAACATGGCCGACTGCGCTCGCGAGCTGGTGGCTTCGAACGGTC
TCAGTGACCGCATAACCGTCATTAAAGggaagatggaggaggtgcaACTGCCCGAGCacgtcgacgtggtggtATCCGAGCCCATGGGCTTCTTTCTCGT
GCACGAGCGCATGCTCGAGACTTTCGTGGCTGCTGGCAAGAAGTGGCGGTGCCAGGCGCCAGGGTTTAAGATGTTCCCGTCCATTGGTACAATGTTCGTG
GCACCCTTCTCGGACGACAGTATCTATCGGGAGCAGATGGCCAAAGTCTCGttctggcagcagcaggactTCTACGGCGTCAATCTTTCCAGCCTTCGGG
CACGGGCAATGGACAACCACTTCTCGCAGCCGGTGGTTGGCTACTTCCCACCGGAGATCCTGCTCAGCTCACGTCCGGCCGAGCATGTGCTGGATTTTGC
TGATGTCACTAAGGAGCAGCTCGATACGTTCGACTTCCCGTTCCACTTTGTGGTAGAGCGCACCGCCATCATGCACGGGCTCGGCTGCTGGTTCACTGTC
GACTTTTTGGGCTCCGATGCGCGCGTTGTACTCAGCACAGCGCCACATGACGCGGGGACGCATTGGTATCAGTGCCGCCTTCTGCTCCCCACGCCCGTTG
CGGTCAATGCGTCTCAGAGCGTCAGCGGGAACCTTCATTTtgttgccaacaagaagTTCAGCTACGATATCGACCTGGAAGGTGCGTTGCTCCCGTCTAC
CTGTTGCTTTGTGCAAGGAAATACCTTACAGCTTTGTTGTGTTTGATTTATGCTGTTGGCAGTTCGTCTGGACGGAACTCCGATCGTGTCTCGGAATCAT
GTTCGGTTGCATGACCAGATGTACCATTACCTGTATTCACCTGGAGCTGCGGCCACCTCTGGCGgaatgcagcaacagagTTCTCCCTACTGAAGTTGGT
GGTGCAGAAGCAGGCAGGTTTCTGTTATGAACTGTTCGCAATGGAACGAAGGCGACAAAGCAGCTAAATATCACTCGGACGCATATATAGGGAAGTTGTT
AGCTGTGACAGACACTGCATCACGTCACTTGTCAAGAGCTGCCTCGACGTCCATAATGTGGTCGACCGCCTTCCTCACGCACGGATCGAAGGCGGCACTT
GAGGTGGCAGCAGCCgtcctctgcttcttgggcgAGTTGCCGTTCATCTGAGCAGAGAACATCTCCATATCGGGTACGACCTCAGTGGCTGGAATACCCA
CACTCTCGAATAGCTCGTTGTCTGCACTGAAGATACGCTGGTGCGGGATTTCAACGGTCCAGTAGTTAGGCAAACGTAGCTGTCGGGTGGGCGACAAGCT
GCCGGCGGTAGTAGCGCCGATCCGACTCGTATGTGGGCGCTTCATCAAGGACAGACATAGCAGTTCCGCCGTGCTATCTCCACACACAACACGACAGCCA
GTTAGTCTGGTTAAACCCCATCGTTCAGACGCACAACAGAACATCTTACCCGCGAGTGTATTGACTCTGCAGCACAGCCAGAGGACCCCGGTAGCGTGTA
CAGCGTGACGTGTACGGGATGTAGTACTTCTTTCTCTTGGAGAACCTTGGCGTAGCTCctggcagcttctcgtccgttGAAAAGGCCAATGCGGCTTTAT
TCTCGCTGgcgaagaacgacgccaccgTCAACGCGGCGACGTGcgagcctcctccttggtTGAAGCGCAGGTCTAGAATCAGTCCGTCCACATCTCCCAG
ACCGAGCAAGATCGCTTCCAGCGACCAGCGCATGGACTCCAGGTCGTAAATCTCCGGCACCGCCACGGAACTGCCAGCCAGACTTCCTCTCCCCTCTCCA
GCCTTGCCATCgacatccagcagcgtctgacCGACACTTTCTCCTGAAATGTTAGCAGAGGATGCGCCTCTAGTCCAAGACGGCATGAGCGCGTCCACTC
TGGGCAGTGGGAACTCCACGAAGCCCTGCATGGCCGTAAGACAAATGTATCCGATTCTCCATCCTGGGCAGGTCTCAGCATTTAAGATACCGCACACGAA
GCGGTCGTTGGCGATCCTGCGGCCTCCCTGCGTCAGATGTTCCCTCTCAATGACAGCTAGAGTATAGTGCTGGAACttcaacgctgcagcagtaggCAGC
TTGTGTCCACGAACAGTGAGCGTCCTGGGTCCTGAAGATCCTGCAGGTCCGGCCACCCTAGAGACCGCGAGCGACGGGTCGTCACAGAGCGACACGCTCT
CCTGCAGAGCGATCCAgaggtcgtcgtcgctcgTGGCTGGCTGAATGGCGTCTCCGAACAGCTGGCGCACGAGCTGCCAGTCCACGCGCCGCGGCTCCAG
GAGCGCGTAGTGGTCCTGCATGGcgcgccagaagctgcggaacGTCAGCACCGGGTCGCGCGAGTACGTCACGCGCGCGAAGAtggcgcgcagcagctcc
aggaacaGCCGCAATAGAATTCCATGCAGCGTCATGAGCACGACCAGCGCGCCGCCCAGCACGGGCACGTGGCGTCGCAGGAAACTCACGGGCAGAATGG
CCACAGCCTCGTAGAGCTCCAGAGGCCACAGgatcagcagctgcagcagcgcgtcggGCGTCAACCAGTTCAGACGCAGCGGCAGGAGCGCCCAGATCTT
CCGAGTCGCAGCCAGCATCGTTCGCTTGTGCGGCTTCCTCCAAGGTTGCACTCCAAGTGCTGAAGTGAGGCCGTCGTGTCAAAGGCCGCCGGTTGGGTGA
GCACTTATTCTGGAACGGACTGTTGATTTGGGCCACAATGAGATTTTCAGTAGTCGAGTTGCAAAGTAAGAACCTTTTTTTTCACGAATAGATACTTTTT
TGCTGGTTATTTAGCTGACACTTTATACACACTGCGACGTGGCCAATAACAATTAGAGGCTGCTGTagcggtgctgctcgtgcgGGAGGACGTTGGCGAG
TTGCTCCTCGATGTAGTCGCGTACCAGCGGCGAGAACACGTCGAGCTGCATCTGTCCGTTGAACATGGCGTCGTGCCCGAACTTGGAGTCCACCTCTACG
AGCTGCGCGTTGTGGCCGTACGACTGCAGGATGTTCACCAGGCTGCGCTGTTCCTGGATCGGAATCAGTAGATCCTGCTTGATGCCGATGACAAGGCTGT
CGCACGAGATGCGGCTCGTGCCCTCGGCCAGGTTCAACGAGTTGCGGCCCAGGTTCGTCAGGTCCATAGccttggacagcagcaggtagCAGTTCGGGTC
AAACAGACGAGCAAACTTGTTCGCTTGGTAGTCCATGTAGCTCTCAACTTCGAACGTGGCCGTCTTGAAATGCATGGGACCCGTCGGGTTCCAGTCGAAA
CGCGCGTCGAACTCTTCGCGCGAGCGGTAGCACGTCATTCCCAGCTCACGCGCCACCTTCATTCCCTCAAGCGGCACACCGGGCGTGTAGTTGCCATCCT
TGTACTCCGGGTCGGCGAGGATCGCACGGCGCTGCACACGTCGAAAGGCGACCGTGCCAGGGGTGGTCTGGTGCGTGCAGGCAAGTCCGACGAGGCGGTC
CAGACGGTCCGGGAACTGGGCCGCGAATTCAAGGGCCTGGATGCCGCCCATGCTGGCACCGATGACGGTGTGTACGCTGTCAATGCCCAGGTCGTCCAGG
ATCTTGGCGTGGCAACGAGCCATATCAGCGGGCGTGAGCTGCGGGAATGAagccttgtacttctcgcCCGTGAGCGGGTTGACCGTCAACGGCGATGTGG
CTCCGAACGGACTGCCCAGGACGGACGGACAGATGACGCGGAAGTAGGACGTGTTGATGGCCTTGCCAGGACCGATCATGTTCTCCCACCAGCCAGGACG
GGGGTCATCTCGGTTGGAGGCAGCGTGGCTCGAATGCgagaacgacggcagcaccagGATAGTGCGGTCTCCAGGCAGCGAGCAGTCGCCCCACTGCTCC
CAGTCGATGGTCACCTCGGGCAGTGAGCcgcccagctccagtgggAATTCCTCCTTGAGTACGGACTGGTACTTATTGCGCGTGAGCGTGAAGTCGCCAC
CGCCGTTGTGCTTGGGGTCCACCACGTACGagcgctgctgttgcgcGTAGTTCAGCACACTGCGGCGTGCGAGTTGTGAGGCTGCAGGGCTCTGGCGAAG
AGCTGCCTGTGCGATGCGACTGCAAGGAGAGAGAACTGTTAGGTGTCGAGCAAGAGAGCGGTTTGCACACACAAGGAATAGCCTACCGAGCGAGCATTGT
ATTGTGCTTCCTTTCGCTCTGAGCTCTGCAAGGTAGAAGATTGAATGAGCCCGAAGGTAGGTTTTGGTTGGACCGTGACGAGGCGCTAAATCGACACTCC
ATTGGTTCAAGTTTACCTCGCTTTACGAACTTCTGAAAGATGCTCACAGTTTCTTCGATAATTTGATCTTCTCATTTGTATGGGAGCAGATTGCGTCCGG
GCAAAAGTGCCCCGTAGGAGTTGACAGCCTTTCTCTTGTCTCTGACATGCCGGTGCGTTGATGGTCGTTCGCATATTCGACGAGCGTCGAGAGCGAAGTG
TGCAAGACGATCAAAACGAAATACTATGGCGCTACGATGCTGatgtcgacggcttcgttcTATTATAATAGGTCATGACCAAGCCGTaatggaagaggaa
ctgcagtCGATTGAGGCCAACCGCGTCTGCATTGCGCCAATTGTACTTTAGTGTTctcgagtttgctgcagcaacgatcgTTGTTCGCCCTTAATACAGC
TACATGTTTCTTACACGAAATTGTCCGTTGAATGGGACCATCGAATCGATAGTATCGATGgcagtgcagcttcgtccaggCGACGTGTTTCATGCAGTGA
AACGATCTGCTCAATCAGTCAGGCGCATTACAAGGGTAACGTAAGGTAGAGTAGGGGACAAAACTACGGTAGTAAGTCGCCTTCTATCGTCAATACCGGT
ATTAGAGACTACACAGTACTGTAGCACCATATTTTGACCGAAACAGCTTTGTCATCGTGAGTCATCCGAAATTCGTCTTCAAAATTTCATAGACGGGATA
ATTTTTGATGGTCGTGTGAAAAATGCATTCCGTTTATTTTGTTCGGTACGAACTAACATCAATCTTTATGTCTAAGCATAACCAGCAAACGCTAGCGCAT
TTACAAGTAAGTCGTGTCGACCCACCACTCCGTTTCGTAGCCCTCGCCGAGGACCTCGTTGATAGCCACGGGAGCGTCCAGCTGTCCGCTGAAGGCAACG
CggttggcggtggcggcgcCAGGGCCCGAGTTGTTGAATTCCTTAAAGATCACCTTGtccgtgctggaagtggcgtCCCATTTCGCCCACCCCTCCGGCT
TGACCACATCGCCGAGCTCGCTGTTCTGCCAAATGACCTTGGCAAACGGACGCCACGGGCGGCCCAGCACCGTCGAGTTCACACCGCTCTTACCGAACAC
ACGGGCCttgttgaagacgtacgtGGCCGAGCTGGACTCGGATTCACGGCCGCTGGCCGTGATGAAGCCAGTGCCAATGGTCTCGATGTCGCACTTCTCG
AACCAGGCCTGCGCGTAGCGGCCGAAGACAAAGTCGGTGGCGCCGTTGATGTACGTGCGCGCGTAGAGCTCACGGCCCTTGTCAGCGAGGACAGTGTCCT
GGTAGCCCGTGAGGTTGCAAGCGTAGAAGCCGTAGTCGGTGGCGTTGACGTTGACAGCCAGCGCCTGACCGACGTTTCCGGCCGTGTTGGCGATGTTGAG
GTTGTACACCTTGACGTTGTCCGAGTAAAAGCGCACCGTACTGGTCATGTCATTACGGGACTCACCCGTCACCGTGGCAGGGATGTCCTTCTGGGCCTTA
CCCTGGGTGATGGTCGCCTCGTTGCTGGAGTAAGACGTGGCGTCGCACGTGAAGCCCTGCAGCACCAGGGGGCCCGACAGAGGGGCGACGTAA