Description :
From Genome Similarity Track
Location :
contig_1:224782- 226024
Transcript NameFunction/comments
g75.t1RAW43777.1 hypothetical protein PC110_g106 [Phytophthora cactorum
g76.t1hypothetical protein

Sequence
1242 bases(100 bases per row)
CCGTTGCACCTGCTCGGCCTCGACCTGTACAACAACCAGGGCCACGCCGTGGCAAAGCGCGTGAGCTTCGTCAAGCGCGAGTACGTCAAGTCCGTGCTCG
CTCGTATCGGCCGCATTGGACCTGCCTTCGGTATTGGTGGAGTGGGCAACACCTACTTCCGCAACACCCTTCGTGTGAAGCTGGATTAGAGATAGACCAA
GGGATCGAGATGCAGCAGCCACTGGACGGGCCTTCTAGCATGCGAGAAGCGGCGAGTCACCGACAGCGTCAACGGTCAATCGATGCGTTGATACTTTGGG
GCGAATATATATTGTATGGCCAGACCTTGGCATGCTGCTTGTACGTTGCTGTTTGTTCGTGCTCCCACCAATTGCACCGATGCGCTTCGTACCAGAAGCA
TGACTTGTTTATCGTCTACATTCGTCGACATTTCGTGTCGATATGCTTTGCTGCTAGGTTGTCTTCCTACTGCGTCGGCGCGTCAGTTAGATGTTGCTTT
TTTCCTGGACTACAACAGGTTGCTGCTGCGCTGAACCGCGTTCTACATGTAGTCTTCTGCAGTGTCATCGTCGTCGTCCTCCTCCTCCTCACCCTCGTCC
GACGGGCTCTCTTCCTTAAGCGCCAGCGCCTCGACTTCTTTAATCTCCCGCTCTAGCTCTGCAAAACTCTTCAGCACCTTCCGTACGCTTCGCTCGGCCT
TGTCAGGGCTAATGCGAGACGCCGACGAGCGGGCCTTTTGCAGCTCTTTATAAAGTTCCGTGTTCGGGCCCTGCTCAGGAGAGTATTAGCAATGCGCAAC
CGTCAGCACTAGCATCAATAACAAACTATTAAACGCCCTCTACGAACCTCGTGCTCTGCTAGCACCTCCATTTGCTTGTCGTAAGCTTGAAGGAGCAGCT
TCAGTAGCTCCTCCGAGGACTTTGCAAAGAAGTGCAGGAACGACGGCTTTCCCACCGATGACCTAGTGTCTATGATTGAGCCCAAGTCGTCACCCTACCC
AACAAACACGGCACATCTATCAGATTATAAATCGCTTGCAGTCCGGATCACCAGCAATTCAACGCACCTTTACGCGGATAAAGGCACCGGGGTATCCGTC
CAGCTCCTGAACACCATGCAATTTCTAGATACAGAAACCAGCCCCACAGTGTCAGTTAACTGGAACAACAATAGCAGACTCTTTTGTCACTCACCGACGC
AGATTTCTTTACTGGGGGCCACTCAATCGCGTACCACCAGCG