Description :
From Genome Similarity Track
Location :
contig_21:22472- 25069
Transcript NameFunction/comments
g4756.t1hypothetical protein
g4757.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
2597 bases(100 bases per row)
GGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGTAGT
CGCTCCATTGATGGAACGAGTGCGGGTAGCTCTTCATGGTGTCAACCAACACGCGGTTGACACTCTCTGTTTGTCCGTCGGTCTGTGGGTGATCCGCAGT
CGACATGGACAACTGTGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCTCGCTGTAAAGCGCAGATTCCGATCCGACACGATGTCGAGTGGCATACCA
TGGTGTCTAAACACCAGGTCAACAAACAGACATGCTGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAA
CAAAGACCACTAACCAGTCCTCCGCTTGTTGTCTTACGGAAGATCAAAAACAAAGTCCATTGAAATGGACTAGCACTCCGACGGAATCGGTAGTGATTGA
AACGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAGTAGAAGT
CACGCGTGAGAAGTAAATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCATCATCCGGCACGACAATG
CGATCTGCGTTGTCGTCGACGGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGACGTGTTTGGTCAGCTTCTGACGAGACTTGTC
AGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCATGCGCGTATGCGGCCTTCACGTCATCCAGCAAGGACGACGCCAACTGCGTTGGCTTCGGC
CTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCATGTATTCCGTAAAGAATGACAGCCACC
GTGCCATTCTTTGGGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGCCTACTCCCAAGTAGATACACTCG
AAATTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACA
CGATCACGGCCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCG
CCAAGATCGGCGGCTCAGTCAAGCCCTGCTTGACTGCTTTAAAGGCCTGCTGACAATCAGCAGTCTATTCCCATGCAGCTTCTTTCTTCAAGAGCTGCGA
CAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGGACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGC
CATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACT
TCTTCAGGTTCGCATAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGACCTCCCATTCACAGCCCG
GCTGTGAATGAACACATCATCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGTGTTTTTC
AGCCCCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACACATGAGGATCTGATAGAACC
CGTCTCTCAGATCAAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATC
GTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGCTTCTTGACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGT
CCTGCTTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGCCGCGTGACGCAATACCTCGTTCCCGGCACGA
GATCAATCTCGTGCTGAACACCCTTATCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACTTTGTAAAAGGGGCT
CGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCGGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCT
GCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCATCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGA
GCGACATCAACTCCGACGCTAACGTCGGAGGATTCTCCAGCCTAATTTTCTTGTATTGGAGACCAATGCTCGTACGCGTCAAGACACTCAATGTCTC