Description :
From Genome Similarity Track
Location :
Scaffold_66:224710- 225752
Sequence
1042 bases(100 bases per row)
GAGCAGCTGACTTTTTTAATTGAGTATCGCGCAATCTGCAGACGAGTGGACGCCGGTAGTGACCGCAATGTGTCATCCGAGGGATAGCGACAATATTAAA
CAATCGGCGATGTAGCGGAGCTACACAGCTCTTTAAGTCAGAAGAAGACTTAGTGCTCAAAGAGCGATATTAGTTCTAAAGAACTAGACTCTAGGAGTCA
ACAAGCGTAAAGCTGAAGGTCTCTGTTACAGGGGACCGAGCGATTCAGTGAATCTTAGTGATCAAGAGTAGATACCTCAGGGAGATGTTGCTAACTCTTA
ACGATCAACGATCAGAGACGCCTCGCAAGGCACGTGTCTTAGACAAGATCAAAAGGGGAACTGAACTTTATTTACATTTAACTCTATAGAATATCTTAAT
CGTAATATTACCTAATCTAGGCACTCACGTCCTAAATTAATATCTTGTAAGATCTTCCTATCTTGTGGCTGACACCCGTCAGCCCCTATAAGCCGATAAG
ATGTTCTATATCTTTTTCAGTGGGATACCATCCTGTGTGTCTAAGACACAGGGTACCGAGTAACCTTCGATGTGAAACCCCTTTACAGGCGACGGGAAGC
TATCGCGATGGTATGATCCCGCAATGTCAACGCGTAGCGGGTTGTTTTATTACACAGTCATTCTATTGACTCCAAGCTTGACACACGTAGCCCAAACGTC
CTCATCAAAATCGGTTGTGCCGGACGTAATACGTCTGCTTTTGGATCAAAATCGGGACGGCGCGACAAAGCAACAGCATAATTTTTTGTTGATCCCGGCT
TGTAATGGATTACGAGGTTGTATTCAGCAAAAATGACAACTAGCGCGCCATGCCCTGGCTGAAATCTGGACTCTACGTCGCTGCACGCAGAAAAAAATAG
TCTGTGTAGATGGCGAAGGTCTTATCTCCAATCCAATATACGCGAAATTATACGAGCGCATATCGCATCACGAGTAACCCTTTATCGTGGACAGGGTAAT
TCCAAAATCAGGATCAGCTGTCGAGATTAATACCTAACAACA