Description :
From Genome Similarity Track
Location :
Scaffold_14:224707- 225781
Sequence
1074 bases(100 bases per row)
CCGGTTTAGTCTCGTTCTACACAAGTGCACAACAGTTCACTCATAACCACTTTGCGTTTTTTGGACTCCCGTGATGAGTGGTATACGTAAAACACGTCGT
CACTTGATTGGATAACCTTGTACGAGGGTGCCAACGACTTCTCGACTTCAACTTTGCCAGACGCATAGGGTGTGACAACGAGTCCCTCCACCGCCCACTC
TTGCGCCAGTTTACTTCTGTTCGCTACGTCCCTGGCACACTCGTCCATTGAGATTAGCACCGCCTGGGCTGGTAAGGACTGCCTGCACTTCTTCGGAAGC
GCTTTGTTGTTGTCGGATTCAACGAAATTCGTTGTCCTGCAGTTGTACAGGCGTCTGCGGCTTGGGTCAGTCGACGAAAGCATGTTGGCGTACACTACCC
ACTTTACAGGCTCAATCGACCTCAAGTACGTAGCCACAGGTGCACCAAACAAGCTCACAATGCGATCCAGACACCCGTCATATGCCGACACAGTTTCACT
GGCTTGGAGTCTCCACACACAATGCTCAAATATTTGGCCAGCAAGGCCAAACTTGCTTTTGAGATTGCCAATGATATGCCGGGTGCAGAACTTCAAACAC
ACTTGCTGACCCGTTCGGGACAAAACGTCGGAAGCAAATTGCGATTTTCCGCGGTCAACAAACGTGGCGCACTCAGCCAAGTTGGCCCCAGCTTGGATGC
AGTTTAGGAAAAACCAGTGATAGTTATCACTGGTTTCCTTGGCCACAACACCGAGGGTGATGGGGACGTTTTTCCCGTTGCCGTCGCGACCGACCAGATT
GATAAACACCCCGTTGTAATCCTTGTGTTTGAAGTGTGCGCCATCGGACCCAACGAGCTTCAAGTTAGCGTGGTGGGCATCAGCGTACACTTTTCCGCAC
ACAAAAGCCCGATAAAACCGACCATGGGTGTCAGCTCGAAATCCACACGCGACCCAGGATTGGCTCGTTCAAACGCCAACAATATGGAAGGTAATAGAGA
GGTTTTGCAAGTGTCCGTTCGCGTTCGCGTTCCACTTTGCTGCCAAAACCGGAAGTCGACCTGTTAAACCTCAT