Description :
From Genome Similarity Track
Location :
Scaffold_14:224691- 226264
Sequence
1573 bases(100 bases per row)
GTGGCGGCAGGGCAGCCCGGTTTAGTCTCGTTCTACACAAGTGCACAACAGTTCACTCATAACCACTTTGCGTTTTTTGGACTCCCGTGATGAGTGGTAT
ACGTAAAACACGTCGTCACTTGATTGGATAACCTTGTACGAGGGTGCCAACGACTTCTCGACTTCAACTTTGCCAGACGCATAGGGTGTGACAACGAGTC
CCTCCACCGCCCACTCTTGCGCCAGTTTACTTCTGTTCGCTACGTCCCTGGCACACTCGTCCATTGAGATTAGCACCGCCTGGGCTGGTAAGGACTGCCT
GCACTTCTTCGGAAGCGCTTTGTTGTTGTCGGATTCAACGAAATTCGTTGTCCTGCAGTTGTACAGGCGTCTGCGGCTTGGGTCAGTCGACGAAAGCATG
TTGGCGTACACTACCCACTTTACAGGCTCAATCGACCTCAAGTACGTAGCCACAGGTGCACCAAACAAGCTCACAATGCGATCCAGACACCCGTCATATG
CCGACACAGTTTCACTGGCTTGGAGTCTCCACACACAATGCTCAAATATTTGGCCAGCAAGGCCAAACTTGCTTTTGAGATTGCCAATGATATGCCGGGT
GCAGAACTTCAAACACACTTGCTGACCCGTTCGGGACAAAACGTCGGAAGCAAATTGCGATTTTCCGCGGTCAACAAACGTGGCGCACTCAGCCAAGTTG
GCCCCAGCTTGGATGCAGTTTAGGAAAAACCAGTGATAGTTATCACTGGTTTCCTTGGCCACAACACCGAGGGTGATGGGGACGTTTTTCCCGTTGCCGT
CGCGACCGACCAGATTGATAAACACCCCGTTGTAATCCTTGTGTTTGAAGTGTGCGCCATCGGACCCAACGAGCTTCAAGTTAGCGTGGTGGGCATCAGC
GTACACTTTTCCGCACACAAAAGCCCGATAAAACCGACCATGGGTGTCAGCTCGAAATCCACACGCGACCCAGGATTGGCTCGTTCAAACGCCAACAATA
TGGAAGGTAATAGAGAGGTTTTGCAAGTGTCCGTTCGCGTTCGCGTTCCACTTTGCTGCCAAAACCGGAAGTCGACCTGTTAAACCTCATATGGAACGCG
AACGCGTACTCTTAAATCTGATTGCCAATCCGCTTGAAGTGTACATCTCACGGACTGGCAGTCCGGTCTGCTCCGTGATAACTTCATATGATTGGTAGTT
ATTGGCCAATCAAGAACATTGAGATTGTACCGGATGACTGGGATAACTGGGCGCTCAACGTAGCTTAACGCACATAGCACTAAGAAACGACGTCGCTGTG
TCGTTGTTTTTACGAAGGGGGCAAGCGAGGACAGCTCCGACTGCGTGAGCACCATCGCTGACAAAGTGATTTCCTGCCTTGAATGAATATCCGAATAATA
TTTACTTATACGGATATTTGTGAGCAGAACGCGAACGCATTCGTGCAAAACAACTTTGTTTGATATTCCGTTCAAACTGCATCTGACACAAAAAGCATGG
TTCGGAGCAGAACGCGACCGCGAACGGACACTTGCAAAACCTCTCTAATGTTGCAGTTGAACTTGCGACATCG