Description :
From Genome Similarity Track
Location :
Scaffold_211:22469- 24007
Transcript NameFunction/comments
Phyag_g3527hypothetical protein

Sequence
1538 bases(100 bases per row)
AGATgattttgttgctgcagcacaagccCCGAGCAGTTGGTAGTTTCGCCGTCTTGGTTCCACCACTATCCTGGATGTCTATTATCATTCAACTGCTTAC
CATCGCTCGAATGGAAGAGCGAATTTGCTGGTCAAGAGTGCGACGCTGGTCCGGGAGATCTGGGCGTGCCGAGAGTATCTATTGAAGATTGAGAAGCACC
AGCTTCGAGTGGACTGTCCGTCTTAGAGGCGCaggcagaagaagacagAACGAGGTATCGGCTTCTTCCAGGGCGAGCCCATCCATGGTCAGAGTAGTGT
GAAGTAATTTACGTTAGTGTACGTTTTTCATCGACAGCGTAAGGTctcacttcttcttcgagcagctcttcttgttcatgaGTACTCCGTGAACGTTTCA
ACCAAGGCAGAGGCCAAGCAAAAGCGAGCGAAAAttcggtgaagaagagcacgcaAGAATCAGAAATCGGTCTCCGCTACCGAAGCCTTAGGTGAGATCC
ACGTTACGTTGTGCTCCTCACATGATCCATAATGGAAGAGTTAAGGCCAGTCTTGATGAATAAGACGCACGACCGGTAGTGACTTCGTTGCCTGTCGACA
AGTCGGCTGTCATGGAGTTCACCGATACCGCCGAGCTCACTGATACATCATGGCCAaaacgagctcaagaaaaGCACGGTGTGCATTTCGGATGTCATCG
AGACGACATCTACGGCTGGTGCCAAGGAAAATCAGATCTTGCCGCTCATAGGATCAATCCTCGTACACGAATCACCACACTGCTGAACAGCGAACACGAA
GGCTAGCTCATTCTCGTCATCGGAACAGCTAAAGACTCTGCATGGCGATATGTCACTTCACCTTACAACGAAAAAGAGAGTTTTTGCGTCCAGACTCATC
GAGTCAATACTTTGCCTAGACCCAGCAGTTCAGCATCGTCTGAGGCGCGGTGTACGTGGTCGGAGGCGTCTAGCTGTTATGGCCGGAATTCCATCACGTA
GCAAACGCGAATAAGAGAGACCGAGCCACTGTGGCGAGATCATCCGAAATATCGTGAGTCGCACTGCTGCACACACACGAGTCTCCTGCTATCGAAGACA
TACTTCTTTACCTACGCCTTCGTTACCGCTCATTCGCGCCTATGCCATTCGCTGAATTGCCTCCGTGTGAAAGGAGACCTCTTTCTCCCTACGACCAGTT
CATTTGGAGATTACTTGGTACCAGGCCGTCACGCAGGTATAGCATCTAGTTTGTAGTGAGAAGTGGGTAAGTAAGAAATGTTCAAATGCTGTCATGATGG
AGATGTCCTCCGACGTGTAATCTCTACTTGAAATCTTGGGTTGACACCTGTAACCAGTCGCTAACATGCCTTGGATCATTGTATTTTTCACGGTGATCTC
CGTAGGGTGGTCAATTGCGAGACCTCACGACCTGACGCGATACTTAGCGAGCCACCATTTCGGATCCACTGCTGACTAGCACTATGTCGAAGGACGACCT
AATGGAGCAGGCGTTGCCGAGACTTCAGCTGTCGAGTA