Description :
From Genome Similarity Track
Location :
Scaffold_485:22467- 25316
Transcript NameFunction/comments
g17002.t1hypothetical protein

Sequence
2849 bases(100 bases per row)
AGCAACACGCGGAGCGCAGATCACATCTCACACAGGAGGAGCGTGCCGAGGAGCGGATAGTAAACCAAGAGCAACACGCGGAGCGCCGTTCTCAGCTTAC
ACACGAGGAGCGCGCTGAAGAACGCATGGTAAACCAGGAGCAACATGCCCAGCGCCGATCACAGCTTACGCAGGAGCAGCGTGCCGAAGATCGCATGGTA
AACCAAGAGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGAGGAACGCGCCGAAGAACGCATGGTAAACCAAGAACAACATGCGGAACGCCGCAGAG
AACAGACCGAGGAAGAAGCACTTGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGA
CGTGGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAA
TCAAAAATGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGCCTGCACCTCCAAGATTGTTGCAACTGTACCTGGATCCAGCGTTTCGAC
AGCACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAGGACGTCAATCAGGATGCAAGCGTAGC
GGGACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACG
GATCCTAAGTTCGCGCAGATCTATATTGTGAGCCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATCTTTGCTGACTTGGATCCTGTGGCGTTGA
TGGACATTGAGCAAATGATGGAGCAGCACAACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGA
TATGGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTG
GATAGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTACGACTGTTCGAGACGCGCCCGGAGTATGATCCTCTTCAGTATCCTCTTCTGC
TTCCGTATGGGGAGCTGGGTTGGACCTACACGGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTT
CCGGTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACGCGCTAAATGCGAGCAGGGC
AACTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACAGAGGGCTTCAGGATGCACTGCTGAACGAAGGAACAATTCAGCTGGAAGC
AGGCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGAGGTGGTGATACCCATTTTCTCAACCAAGTGGGA
CGCCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCGATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGAGAATTCGGCAAGCCTG
ATGTGTTCATGACAACGACCTGCAGCCCTACATGGGAAGAGATAGTCGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGACCGCCCCGATATTGTAGC
CCGTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAAG
AGAGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCGCGTACTCGCCAAATCGTAGATCGTATGGTGTCTGCAGAGCTTCCTG
ACAGAGAAAAGTTCCCGCAGCTATTCGAGACGATCATGACATGCATGCTGCATGGACCCTGTGGAGCAGCAAACCCGTCATGCGCTTGCATGAAGGACGG
GAAGTGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTCGACGAGCTGAAGGCGTC
TGATATGGAAAGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCAAAAGTACAATTGCCACATCAACGT
CGAGGTGTGCACGGATATTTCAGCTGTGAAATATCTATACAAGTACGTCTACAAAGGGTCCGATAAAGCTGTGCTAACTGTCGAGGCAGTTCGCGCGGGT
GGAGAGCTCCCTCGGCAAGAGCCAAACGAGATTCTGCGCTTCCTCACGGCCAGGTACATATCTCCAGTTGAAGCCTGTATCCGCTTACTCGACTTCTTGA
TCCAAGGAAAGACACATGCAGTCACTCAGCTTACCGTTCACGTCGAAGATGCCCAAACCGTGTTCTTCAGAGCGACGGAAGACCCGGAGCGTGTCCTTGG
TCGTGGGAATCACACAATGTTGACCCGCTTCTTCGAATTGTGTGCGAGCGACGAACCTGAGAACCAGATCGCGAAGACAATGCTGTACCAGGATATACCC
AAGGAATTCCGCTGGATGGGAAACACGAAGTGCTGGGTTCGACGTAAAATGTACCAGGCTGCAATTGGTCGGATGGTGCATGTTTCACCGCGTGATATGG
AGCGCTTCTATTTACGCCTGCTATTATGCCATCGCCGAGGACCGAGGTC