Description :
From Genome Similarity Track
Location :
contig_21:22467- 24993
Transcript NameFunction/comments
g4534.t1hypothetical protein

Sequence
2526 bases(100 bases per row)
GGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGTAGT
CGCTCCATTGATGGAACGAGTGCGGGTAGCTCTTCATGGTGTCAACCAACACGCGGTTGACACTCTCTGTTTGTCCGTCGGTCTGTGGGTGATCCGCAGT
CGACATGGACAACTGTGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCTCGCTGTAAAGCGCAGATTCCGATCCGACACGATGTCGAGTGGCATACCA
TGGTGTCTAAACACCAGGTCAACAAACAGACATGCTGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAA
CAAAGACCACTAACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTAGCACTCCGACGGAGTCGGTAGTGATTGA
AGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAGTAGAAGT
CACGCGCGAGAAGCAAGTATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCATCATCCGGCACGACAA
TGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGTGTTTGGTCAGCTTCTGACGAGACTTGTCA
GAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCATGTGCGTATGCGGCCTTCACGACATCCAGCAAGGACGACGCCAACTGCGTTGGCGTCGGCC
TCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCATGTATTCCGTAAAGAATGACAGCCACCG
TGCCATTCTTTGGGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGCCTACTCCCAAGTAGATACACTCGA
AATTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACAC
GATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGC
CAAGATCGGCGCTCAGTCAAGCCCTGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCTCTTTCTTTAAGAGCTGCGACAG
CGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCAT
TCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCT
TCAGGTTCGCATAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGACCTCCCATTCACAGCCCGGCT
GTGAATGAACACATCATCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGC
CCCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGT
CTCTCAGATCAAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTT
CAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCT
GCCTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAATACTCGTTCCCGGCACGAGATC
AATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACTTGTAAAAGGGGCTCGCCT
TGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTC
ACACGTCATCCTCTCGACGTCCGAGAAGATGCAGATCTGCTCGATGCGTCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGAC
ATCAACTCCGACGCTAACGTCGGAGG