Description :
From Genome Similarity Track
Location :
Scaffold_202:22458- 23568
Sequence
1110 bases(100 bases per row)
AGGATTCACTTGAGCCAAAGAGCTTTTTGTAAACCTTAGGACATAAAGATGTACTCGCCTTCGAAAGTCGATAGAGCGACGATGTTTTGAAGCTTGGACT
TCCAACGGACCAGACCTTCATTGAGGAAGATGAAGTAACTAGATGTTAAACGGTGTGTGGTCTTGTCGTTGGCATAGTCAGCATCAACGTAGAGTTCGAC
CGTAAAGGCTTCATCGATGGATTTCTTATAAGCAGGCCAAAGTCTGGAATACTTTCAAGTAGCGTAGGACGCACTTGATGCTCGGGAGCTGGATCGTTAG
AGTGTCTTGAGAGCAATGTCACAGCATCCGCTATGCCGGGACGTGTAGTCGTGGTGAGATAGAGTAGTTTGCCCACTGCATTGTGATAAGGCAAACGATC
GTTATAGATAGCGGAGGAGACAGAAGCAGCAGAGTGTCCAGTGTTTTGAGGCGTTGAAATGGGGTTGCAATCAGAAAGACCGTGCTTAGCAAGTATATAC
GAGACATACAGTACTTGTGTTGGTGCAAGTGGATGGAGCCATTGTCAAGGCGTATAACTTCAATTCCAATGCAGAAAGTCATGGGACCAAGATCCTTCAT
GGTGAAGCGGACAAAAAGATCACGCTTGGTAGCTTCCAGCTGTGGAGTGCTCTGGGAGAGAAGGATGAAGTCGTACACGCCCACCGAAACCAAACCATCG
GGCGAATGTTGAAAGTAGATGCAAGGTTTGGTTTTGAGCGGTGTAAAGCCTTGAGAACGAAAGTACGAATCGAGGGCGGAATTCCATTCACGCTAAGATT
GTTTCAAGCCGTATATACTTTTGTTGAGGCGGTAAGCAAAGTGTTCTTGTCCAGGCTGAATATATCCGGGCGGTTGGCGCAAATCGAGTGTTTCTTGAAG
AGTACCATTCAAAAATGCATTTTGAACGTCCATGTGATATACTTTCAAGGAGTAAATGGTGGCCAAAACAAGTAGGAAACGAATGCTTGAAGTGAGAATG
ACCGGCGCAAAGATGTCTGTGTAGTTAACACCAGCAATTTTTGCGAAACCTTGAGCAACGAGACGGGCTTTGTAACGGGAAAGAGAACCATCGGCAGCGT
ATTTCTTCGA