Description :
From Genome Similarity Track
Location :
Scaffold_202:22452- 23716
Sequence
1264 bases(100 bases per row)
TCTTCAAGGATTCACTTGAGCCAAAGAGCTTTTTGTAAACCTTAGGACATAAAGATGTACTCGCCTTCGAAAGTCGATAGAGCGACGATGTTTTGAAGCT
TGGACTTCCAACGGACCAGACCTTCATTGAGGAAGATGAAGTAACTAGATGTTAAACGGTGTGTGGTCTTGTCGTTGGCATAGTCAGCATCAACGTAGAG
TTCGACCGTAAAGGCTTCATCGATGGATTTCTTATAAGCAGGCCAAAGTCTGGAATACTTTCAAGTAGCGTAGGACGCACTTGATGCTCGGGAGCTGGAT
CGTTAGAGTGTCTTGAGAGCAATGTCACAGCATCCGCTATGCCGGGACGTGTAGTCGTGGTGAGATAGAGTAGTTTGCCCACTGCATTGTGATAAGGCAA
ACGATCGTTATAGATAGCGGAGGAGACAGAAGCAGCAGAGTGTCCAGTGTTTTGAGGCGTTGAAATGGGGTTGCAATCAGAAAGACCGTGCTTAGCAAGT
ATATACGAGACATACAGTACTTGTGTTGGTGCAAGTGGATGGAGCCATTGTCAAGGCGTATAACTTCAATTCCAATGCAGAAAGTCATGGGACCAAGATC
CTTCATGGTGAAGCGGACAAAAAGATCACGCTTGGTAGCTTCCAGCTGTGGAGTGCTCTGGGAGAGAAGGATGAAGTCGTACACGCCCACCGAAACCAAA
CCATCGGGCGAATGTTGAAAGTAGATGCAAGGTTTGGTTTTGAGCGGTGTAAAGCCTTGAGAACGAAAGTACGAATCGAGGGCGGAATTCCATTCACGCT
AAGATTGTTTCAAGCCGTATATACTTTTGTTGAGGCGGTAAGCAAAGTGTTCTTGTCCAGGCTGAATATATCCGGGCGGTTGGCGCAAATCGAGTGTTTC
TTGAAGAGTACCATTCAAAAATGCATTTTGAACGTCCATGTGATATACTTTCAAGGAGTAAATGGTGGCCAAAACAAGTAGGAAACGAATGCTTGAAGTG
AGAATGACCGGCGCAAAGATGTCTGTGTAGTTAACACCAGCAATTTTTGCGAAACCTTGAGCAACGAGACGGGCTTTGTAACGGGAAAGAGAACCATCGG
CAGCGTATTTCTTCGAGAAGAGCCAACGACATCCAATGGGCTTTCGACCGATGGGAAGTTCACAAAGAGTCCAGGTACCGTGTTGCAGCAGGGAGTCATA
CTCAGCTTCGGTGGCTTAGATACATTCATCGCGTTCAGACGAAAAATTGGTTTGACGGGGCGTA