Description :
From Genome Similarity Track
Location :
Scaffold_1:2245157- 2246583
Transcript NameFunction/comments
g686.t1RAW31713.1 hypothetical protein PC110_g11933 [Phytophthora cactorum
g687.t1KUF96720.1 Hydroxymethylglutaryl-CoA lyase [Phytophthora nicotianae

Sequence
1426 bases(100 bases per row)
AACATGGAGTCGGGTACCTTGAGCAGAGTCCTCGTACAACGAGTGCGGCGTCAGCAGTGGCTGCTTGTCTCCAATAGCAGTCATAGTCGTAACTGTGTGC
GAGTGAGTCGGCGTGTCCGCAATCTGTTGCGACTGGCGCATGTGGTCAATAAAAGACCTTCGCGCCGCGTCGTTTTCGCGCTGCAGCGTAACCAGCGCCT
TGATCTCCTTGCGTTTGTACTGCGCCGGATCGTGATCATCTCCGAGCCACATGTCGAGTACACGGCTAATCGGATAGCCGATCGGGCACGTGATGGCCAT
TAGAACCCTCACAAAAGGGCACAACATAGCAGCGATCTTCAATTGATTAGGACCCGTAAAGACTGCTGACGGGATGATCTCTCCAAACAGCAGCACGCAG
GTCACCGAAAGCAAGATGGAAATTGCTTCCGGTACCAACTTGTTGAGGAAAATGGGGAGTGCTTCGTTGGCGCTTGCATTGACAATGAGCAGCGTCACCA
GTAGCAAATGGTGCTTGGTGAGCACCGGCAGCACCTGCTTGGCGTATCGCTTCTCCTCGTCCGAGCCTTCCATTTCGAGGATGCGCATGTTGAGCATATC
CAGCGATAGCAGGCCCATGGTCAGACCCGCCATCATTCCGGCCGCGCAGATGAGCACCAGCGACATCACCAGGTACAGGTAGAAGGACGCGGGGTCGCAC
CATGGTGTGAAGAACTCGCAGTCGTGCGTCGCGGCCATGGCGACGGTGGGGGTCGTGGACAGCATGAACAGTCAGGTCGGAGGGGACTGGGGATCCGTCG
GTCAGCGCACTGTCGACCCGTGGGGGGGGGAGAACGGTTGTGCGTCGGAAGTGGGGGCGGCTTGGGGTCCTTCTTGGGAGAGGAATGGGTTTGCACTCGA
CCAGCAGCTTGGTGGTCTCCAAGACGTCGGAATAGGCAGCGTAATCGTGGGTAACGTTTTATGGACCAATTTAATGTGGATTTTGTATGGAGCACAATTG
TGTCGCAGATACATGTACAAAACCCGATGCAGAAGATACAGTCCGTGATAGGTAAATGCCCGGTACCGCCAGTTGCACCTGATACTGCGCACGGCTACAA
AATCTCCATTTGCAGCGGTGCTGCGTCACCCTAAAATTGCTACGGCCTCCTTCTTGACGGCGCGATTTTTGGGTTTGACGTCTTCCTCTGTTGCTGCAGG
TGTGACTTCCACTGAAATGTCCGCTGCAGAAATGGAGGACAGAACATGGTTAGCCTTCAGTTGAGCGATACATCCAGCATGGCAGAGCTCAGTCCGCACC
TGCTTCGAGTGCAGTGGCAGGGGCCTCGGGCATGGCTGCAGCAAGTGCGTCCGCTTCCATCTTCTCGATTTCGGCCAGCTCACTGAGCACGGCGTCTTCA
TCCTCGACGGTCAAGCTGCCACCGAT