Description :
From Genome Similarity Track
Location :
scaffold_37:22451- 26587
Transcript NameFunction/comments
Pl_111483hypothetical protein PHYSODRAFT_313159

Sequence
4136 bases(100 bases per row)
GGCGACATGCTGCTGGAAAAGCCCGAGGACGTCAAGCACGAGAACTCGTCGGGCACCGGTGCGTGTGCTATGTGTAGTTAGGACGCGTGCATAGCTAATG
TCATGCTCGCGGCACTCTAGCTCACTCTGGTTGCTGCGTACTAACCTGTTGTAAATCTGTACACCACAGTGTGCGCTATCTACGGCGTAGACGCGCACCC
GACGCTGCAGCTGTTCGCGACGGCAGGTGGAGACAACAGCGTCAAGATCTGGTCGCTACAGACGCCTCAGGAAGGCGGCATCGCCACGTTTGAGCTGCTG
GCGACGCTGACGAATCACCAACAGGCCGTCAACTGCGTGCGTTGGGCTGGCCACGGCCGCTACTTGGCCTCAGGCTCGGACGATCAACTGGTGCTGCTGT
ATGAGCTTCAGGCGGGTGCTCCAGCTCCCGTCCCCTTTGGGTCCAACGCGAGACCCAACAAACAGAACTGGGTGCGCTGCTCTACACTCGAGAGACACAC
GATGGGTGGGATAATGTCGAGATTGACTGGGTGGATGTGGCTTATGCTGATGACTGCTGTGAATTGTAGATGTGGCGGATGTGGCATGGTCACCGGACGA
CCGCATGCTGGCAACCTGCAGCATTGACAACACCATTTTGATCTGGGATGTGGGTGTTGGGGCACTCAGTGAGGTTATGACACAACCTCTGCAGACGCTT
ACAGGACACAATGGATGGGTCAAGGGCGTTGCATGGGACCCAGTTGGCAAGGTATGCTAGTGAGTGGATCATGAATTGTGCTGTGTCTGATGTCTTGTGG
TGCAGTATCTGTCGAGTGCTGGAGAAGACAAGACCGTGCGTATGTGGAAAGTGGCCGACTGGCAGGAGTCCGACGTCGTGATGGAGCCGTTTGAGGCGTG
TGCTTCCACGTCACACTTCCGTCGGCTTTCGTGGTCTCCTGATGGATCGGTCCTCTGTGCTACACATGCTTTCAGTTCCAAGAAAAATATCGCAGCACTG
TTAAACCGCGGATCCTGGTCAAACGACCTTAAGTTTGTGGGTCATCAGGGTGTGGTAACAAGTGCACGATTCAATCAAAAACTACTCGGTATGTTGCTGC
AACAGAATTTACCACTTCAAGAGGATTCTTACTGACAATGCTGTTCCGCTCATGTAGTTACGAAGGCAGATCCTGACAAGGAATTCGCTTGTTGTGCTGT
GGGTGGTGAGGATGCAACTGTAAGCATCTGGCTGGCACACCTAGCACGTCCACTGGCAGTTATCAAAGATTGCTTTGATTCATCAGTGACAGACTTAACT
TGGTCTACCTCCCAGTCACTTCTCCTTGCCTGCTCGCTTGATGGATCCATCTGCTGCTTCCAGTTTGCAGGCGATGAGATTGGTACCCCGATCTCCGACG
CGCAGCAAAGCAAGCTGCTTCAGGCAAAGGTAGGTTTTACGATTATGCCAAACTTCTTTGCAGGTTAGACGCGCGTGGGGTCTTACATTCTTACTATTCC
TTTTTTGAAATGAAGTATGGATCCCGAGCTGGCATTACCCTGGCATCGACTTTGGTGGAGAACCCAATCCAACTCCAGGTACGTTCAAACAAATATGCGC
CAGTTGGGGTTAGTTACCGAGTTGGATGCATTTTGTTTGTTGTGTATAGCTTGAAGAAAAATCAACGACTTCACCACGACTGGCTGTCAGTCATAATTCC
GGTGCCAGTGCTGCCCCCATAATGACTCACACAACAAACACACTCATTCCAAAAAAGAAGACGAAGCTAGGTACTCAGGTATCAAATACTTTTCAAACCA
AGCCACCAAGTGGAGCAATCAAGAACGATAAAAAGCGAATCGTTCCCGTACAACTAGAATCTGCTGCTCAGCTTTCGACTAACAGCAACCCGGCATCATC
GCAAAACAATATTCGCAACATCTTGGGTCCAACGATCGTGTCACCAACAGCGCCAGAAGTTACACTATTGGACGCTCGCATGGCGTCAACGAGTGGAAAG
GAGGTTAGTGTTGTCCCCGACACAAACAATTCTGCAACAATCCAGCCGAGCTCTACGCCGAGTCGTTGTGATAAGACTGCGCCTGTCCCAAAGGAGAAAC
CAGCTCCGGTGACAACAAACGGCGTGCCGTCTAAACCGTTGAAACCAGAAGTGAAAAAGAACGGGGTTGATGGCATTTCTCTGAAAAGAAAGCGAGAATG
TGAACGCCCTCTAACCCAAGCTGCTACTGTAGTAGCAAAGGCAAGGGAAGTTGTTGCACGACCGCCAAAGTTACTAAACGAAAGGTTCGTGTATTATACC
ATTTGTGATTGTTTGGAGACTAACTCGAGGTACATTTCGTCCTGTAGCAGTGCTATCATGGCCAGCGGAGGTCAATTGCTACCATCTTTTCCGTTCAGAC
TACAGTTCTCCGTAGAAATTGACACGAGCGCACAGCCCTCCATTGCCAATGGCACTTCGTATGGTACAGCAAGAAGTGGGTTGGTGCCATCTAAAGCAGT
AGTGGAAGTTACTGTTCACAACCTGAAGAATCCTCAACCTGAAGAAATTATAGGTGAGCTACGAGTACTGGTTGACCTTGTTTATTCTCAAGAGAGATTG
CTGATGTGTTGGATGAATGCAGAGTTAGGACCAGTTTATTCAACGATTAAATGCTCCGAGGGAAGTGAAGTGAAGTGGATTGATCGCATTCCTGGTCGAG
CCGTTTGTGTAGTGGGAAACGCAAATTATTGTGCAGTCGGCGTACACAACGGCGATCTTCTAGTTCTCAACAGCAGTGGACGACGATTATTTCCGTGCAT
TGGTACGTTTACCAGGCAACCCGTGTGCTTGCTTATCAATTGATATTTACACCATTGTTTTGCTTGTTTTCAGCTTTGGGTAGTGCTATCTCGGTAATGG
AGTGCAGCGTGAGTGAATCGCCGTATCTGTTGGTGATCCTGGCGACAGGTGACTTAAAAATCTGGGATCTAGCTGAGCGTAAGCTTGCTCTCTCAAGCTC
CATTGAGGCAATTACAAATGTGAGTTGTCATTTGCAATTTCACGAGAATGACGTTTAACACTGAATTTCTATCCTTTATCGTGTCGAAGATCACACCAGA
AGACCATCGGAAGTTGACACTTCTCCGGTGCAAGGTGACAACAAAGGGGATGCCGCTGATCACGTTTGCAGAGTCCAACTCAGAAGCGAAAGGCAACTCT
AGTCTGCTCTCCTACACATTCGATACTGCGATGTCATCATGGTATGGGTTTGTAACGGGAGATTGTATTATGGTTCACTGAAGTTGACGATATTCATGCA
CTGCTTTTACATGATGTAGGATGCGAGTGGCAGACGACAGCTTTGTGTTTTCAGACTTTGCGTCTGCTCTCTCAACGGATGCAGTAGCCTTGAAAAGTGT
TCCCGTACGTGTGGATTTGGTTTGTTGGAAATTAGCTGATCTGACGTGTAAATGCCCTGCAGATTGGACCACTGCGACGGCTCCAAAACGCGTCTGGCTA
CGGCCGTACACAGCGAGGAATTGCTTCGGCTATGCTTTCGGGTATGTCGGATCCACTAATGCAGCGCAACGTGACACGTTCGCATCTCGAGCACCAGGTC
GCTACTGCAGTCATCCTGAAAAGTTCCGCCGAGTATCGCTATTGGTACGCTTGATCTTCTCACTGTGACCAATCGCATGATGCTGACGATTTCGGAATAC
GTGGCTTACTACAGGATCCAGGCGTATGCGAGGTTTCTGACCCACGACGAGGATGTAACTCGCCTGGATGATCTATGCGCTGAAATGATGGGTCCTTTCC
ACGCGTAAGTTTGGGTTTCGTGGCTAATCTATCTCATGACACTAAGCACACGCTCCATTCTACAGGCCGTCATCATCGACTGAAGACAAGAACTCTATGT
CAGATGAAGGTGGTGAATGGGATCCAGTGGTTCTGGTACGTTTCCGTTCTTGGTTGACAAACTCGCCATGCACCCACGACTGACAAGATTAATTAATAGC
AGGACCTCCTTAAACGGGACGTGTTGAAGTCGCAAATCCTCCCGACGATCGCCGCGAATCGTGCGTTGCAGCGGGTGGTGGCCAAGTACCAGCTCATGTT
GAGCGAGATTGAAGCTCGCGAGAAGGAGGACGAGGA