Description :
From Genome Similarity Track
Location :
contig_1:224454- 225696
Transcript NameFunction/comments
g57.t1hypothetical protein

Sequence
1242 bases(100 bases per row)
GCGGATCTCGTCGCGCGTAAGATTCTTGGAAATTCTTGTAACAAGTAAAAAACTCAAAACACCTGAATCTTTACGAGAAGTCAAAGCACTTCAATCCTTC
CACAACCGGGCCAATGCACGACGATCAACGTTGTCATCGTTGCTTGGGGTTTTCCTGACTGCCTTTGAACAAGGCTCATTTTAAACGTGCAGAAGACATC
TCGAGCAACCGCAAAACCCAGGATGTTCAAGACGTTGGTGACAACATTCGCAGTGCTGGCGCTAGGCCCCGTGCCTCAAGTCAGCGCGGGCCCTCTTGCT
TACAGTATCTACCAAATCGGCTGCAATGCCGCCGCAGTGGCATACTATTCTGCTGCTGGCGTGGTGTTCGGCACCGTGACTACTGGCATGCTCCCTGGTG
TCATTGGCTGCAACGTCGGTCTTGAAACGTGCATGGCTGCGTGACTTCCCTAGTCGGCGAAGCTGTCCAGATCCCGTGCGCTCTTCAGAAAAGCAAGGCG
AATGCATTTACGGGTTCACTCGCTAGCGCTTCCGCGTTGTGCTTTTGTGGACGAGTGAGCCGGTGATCAAGATAATGAACAAGTATACCCATGCAAATAG
AATCGTTTCCTCTCTCCGGTCCTTCGAGACGGCTGCCCAGCGTAATGAGAAAGAAAGAGAGCTTTCATTAAAACAGCATTGTAGTGGCGGCCTGGGACAG
GCTGCCTTTCAGCAGACACTTCGCACGGTCGTTACCAACGACATGAAGAAGCATGAGAGGGGCGAACTCTCAGAGCAATTGTATATTGCATAGTAAGGAG
GCATATAGCAAAGCGAAACTAACAGAAACCACTGCGGCGCGTGCCGCAGGCTGCATTGAATACCAGAATTCATTTCACCTCCAAGCAAGGATTCTCAAGC
AAGCCAAGGGTCGAAAGACACTACAAAGTTAACTTTAGCTGTGGACAACGATCCAACACGGGCCATGAGCGGCCCCCAGCAGAAGCGAAGTCGGGCGAAC
ACCGCAGGAGATGACGGTGATACGTCGCAGCCGACGACCAAGCTATGGACAGCGTTGGAGCCACCTCCGATTGTCTGTTTCTCGCACGAAGCTCTCGTCA
AGTGGCGGCGGCGGGAGCTATACGAGGCGGCAGTGATTGCGCGCTGCCAGGAGTCGGGTGAGTCGCTGGCCACTGTGATGAGGCCGGTGATCTCCACCAT
CCACCGCCGCTTGCTCAAGACATTTTGTGAATTGGAGCTAAA