Description :
From Genome Similarity Track
Location :
Scaffold_19:22442- 25117
Transcript NameFunction/comments
Hyaar_Emoy2803262hypothetical protein
Hyaar_Emoy2803263ADP/ATP translocase putative

Sequence
2675 bases(100 bases per row)
TTCCTAACTAAACCCTAAAGATGAGCGTCCTTTCCACGTACAAGCCGGTTGCCACGTCGGAGAAGAAGAGCGGCGTGACCTCGTTCCTGCTGGACTTGGC
TGCTGGCGGCGTCGCTGGCGGTATCTCCAAGACCGTCGTGGCCCCCATTGAACGTGTGAAGCTGCTGCTGCAAGTGCAGGCCGCTTCGACGCAGATCAAG
CCGGAGGACCAGTACAAGGGCATTGTTGACTGCTTCGTGCGTGTGTCCAAGGAGCAGGGCGTGAACTCGTTGTGGCGTGGCAATTTGGCCAATGTCATCC
GGTACTTCCCCACCCAGGCGCTGAACTTTGCCTTCAAGGACAAGTTCAAGAAGCTCTTTATGGACGGTGTGAGCAAGGACCAGTTCTGGCGCTTCTTCAT
GGGCAACTTGGCCTCGGGTGGTGCCGCTGGTGCGACGTCGCTGCTGTTCGTCTACCCGCTGGACTTTGCGCGTACGCGTCTTGGCGCTGACGTGGGCAAG
GGCAAGTCCCGTCAATACACGGGCCTGGCCAACTGTCTCACGACGATCTACAAGTCGGACGGTCTTTCGGGCTTGTACCGCGGCTTTGGTGTCTCGGTCG
GCGGTATCATTGTGTACCGTGCTGCCTTCTTTGGTGGCTACGACACGCTCCGTGATGTCGCGTTAAAGGACCCCAAGAACGCCCCGGTGTGGCAAAAGTG
GATGGTCGCCCAGACGGTCACGTCGCTGGCTGGTATGATCTCGTACCCCTTTGACACTGTGCGTCGTCGCATGATGATGCAGGCGGGCCGCAAGGACATC
TTGTACACGTCCACAATGGACTGTGCCGTGAAGATTCTCAAGAACGAGGGCTCGGGTGCCTTTTTCAAGGGTGCGGGCTCCAACATCCTGCGTGGCACGG
GCGGTGCTATCGTCTTGGTGCTGTACGACGAGTTCAAGAAGCTTGTCCAGTAGGCGACTCGTTTGTCTGACCTGGTGGGCTGACTCGATCAGATTGCAAG
TTCAAGGAGATCTATACTTGTTGTGAGAAATGGCAAGGTTGTTTGACATAGACAGATATATTCCGCACATCGAGGAAGGGAGTTTGAATGAATACCTTGT
CATTTCTTTTGGACGACACGTGTGAAATGTCCATTCTTTTCTATCACTTCGGGTCATGGAGATAGGCGGGTAGGATGGGAGGAACACCTAAAGTACGAGC
CGTCAGAGTGGTCAATCGCTGTGGCTCCTCTATGATGCAGATGGTGCGTAATGCGTCTGTCATAGGAGTGCCAGGCGACCAGAGCAAGGATTCAGTGTAG
TCACAGTCCTTATTGTTGCGTCGTGTGCTTGCAGGGCTGCTTGAGCATACCCTCGGCGTTTTTACTGGTGATGCTGCAAACCCTATTGTCTTTCTCGTCT
ACAATGACAGTTAAATATCCATGATCTGCTGCTCCATGCGTATGAAGCCACGCATTCGTAGGAAGCTAAAGACGCTCAGCCCCGCCCCCTCTTCCTCGTA
TGATTGAGTTTCGATGAGTTGAGACTTGGGGCGATGGAACAGTCACGATAGACAAGTCGTCTCAGCATTGCAATTGAGCTATTGCTACGTTTAACGTAAG
AGACAGCTGTAGAGCTTCCTGTCGTTCGTTTGTAGCACGTAGGTATCCGTTGCAAACGAGCGATACTAAGTTTCATTTTTGTGCGTGGCCGGGTTCACTC
CACTTATTGCAAGTGCCTTCCCCGTTGCAGCCGCCCTCACTATTTAAAAACGCACATAGTAGAGCACCCCACGTGGCCCGCCAGATCTTCTAATATGTGA
ATGGCTTGTATAACTTAGACAGCCACCGGCGTTCTAGTATGCGCGAGTTTTTAGTCGGTGAGAACTGGTCGAAGATAGAGAGGTGCTAGTAACAAGGGGT
GTGAACCCTGACACGCTCCTTAATTTAGATTTGAGCAATACCCTCGGACAAGCCAAGTAAGTGCAATTGTTTGACAGTTATTGCGATCTAGCACTACCAT
ATTCGAATCGAAAACAATTGGTGGTCATGTCATAAATATTCGTATCCATAACCTGGATGGCAAGCGCAAGCCACATATCGCGATCACGAAGGCAAGTATG
CGGCACCACTACGACACTGTTAGTCGCCAGCATGAAACGCAAGATCGAGCTGCACGAGTGCCAAAGAATGACCCGTACGTAGACAAAACTCGGATATCCT
GACCTTCCAGGTTACAAAACTGAGCTGTTGCGGTGGAAGCTCTCAGACCGAACAGCTTACTAAAAGCCCATAGTGCTATCCCTGGAGATCCTTGATCCGG
CATCTAAAACCGCAGGCATCGCATACGGATCTCCAAACGCTATCGTTTCCGCACGTTAGCTGCTTTGCTATGCCAAAGATTTAGTGAAGGACGACGGAAT
AAGGCCAGTTGTAAGGTGGTCAGATCTTTTGGAACGATACCTTTGGAGGCACGTGTTTTATCAACTAATCGCGTTGAAACAATAATGTCCGTATTTTTCT
AATCCACCATTTTAGCGGTTTTATAGCGAGAAATAATCTGATAGAACTGTTTTATCCTATAATGTTGCGATTTTCTAGCAGCACGATTTGGGATGCAACT
TTTTGCCTGCATACTGCTCGACGGTTTCAATCGCGCGTGCGAATTTTACTTTGCGTCAACTGCTTTCACTATCAT