Description :
From Genome Similarity Track
Location :
Scaffold_362:22442- 24030
Sequence
1588 bases(100 bases per row)
GGCATCGAAGTGGTCGACAACGCAGACGGTAGTGTCACGTTGTCCCAAGCTCGCTACATCAACGACATCCTGGAGCGCTTTGGCATGCAGAACTGCAAAC
CTGCTGCCAGTCCAGTCGACCTCAGCATGAAGCTCGTTGCCAGTGACGCCCTGACCAAGTTGGATGCGCCGTTCCGTGAAGCTGTGGGTGCTCTCATGCA
CTTGATGACGTCGACTCGCCCGGACATTGCTTTTGCTGTTGGATATGTTTCACGATTCATGGGAGAACCCTCAAGTCGAACACTGGATCGCTGTCAAGAG
GATCTTCCGTTACCTTCAAGGTACCAAGTCGCACGGACTCCATTTTTCACCAGGCAACGGAATCGACTTTCGTGGCTATTCGGATGCAGACTGGGCTGGT
GACCACAGTGACCGCAAGTCGACTTCGGGCTACCTGTTTCAAGTTCTCGGTGGACCAGTATCGTGGGGATCCAAGAAGCAGTCAAGTGTCTCTCTCTCCA
CGAGTGAAGCCGAGTACATCGCACTGAGCCTGGCAATCCAAGAAGGCAAGTGGGTGCACAAGCTTCTGTGTGAGATCCTCGACGCTGCAGGCAAAGACAC
CCCGGATCTCAAGATTTTCGAAGATAACCAGTCGTGCATCAAGATGACGAAGAACCCCGTGAACCATGGCCGCGCCAAGCACATCGACATCAAGTACCAC
CACATCCGTGATGAAGTCAAGCGCGGTGAAGTGATCGTCGAGTACTGCGAGACTACGACCATGCTGGCTGACATCTTGACCAAGGGACTCGGCGGACCTC
GTCACAAGGACTTAACGACGGCTCTTGGCGTTGAAGCGTGTTCGCATTGAGAGGGGCTGTTGCAGGTAATCCAATACGATCCCGCGATGATTACGGTAGG
ATATTTACGCCACCGATGATTAGACGAGTAGGATGATTGGACGAGTACAGAGGGTTGGTGATTGGATGCACCAAATGATTGGATGCAAACTAGGTAGAGA
AGACAGTGTAAGTTCTTATCAATCAATCGCTTCTGAATTTCCATTCTGCCCCTCAAGTGACTTCCCTCGTTTCGGCCTCCTCGCCCCAAGCTTCGGCAGT
CCTCCCCTCGCAAGACACAAGATCCAACCATCACCTTCTTCAAAGCACATGCGCGTTTTCGGGTGCAAGTCCTACGTCCTGACGCCGAAGGAGAAGCGAC
TCAAGTGGGACCCCAAGGCTCGTGAAGGCATTTTCATGGGCTATGAAGAGCGTTCGAAGGCGTATCGCGTTTATGACATCGAGGCGGATCAGGTGGTGAT
TTCTCGCGATGTCACTTTCGACGAATCCACCTTTGACGACGTCAATGTTCAAGATGACGGTGAAGATGTCGATGATGCGGCGGATATCCTAGACGACCTC
GAGATTTCGGATGACCATGGAACTCGTGAATTCAGGCAGGCGGGGAAGCGCAAAGCTCGCTCCAATCCTGACGAGCGGGAACAAGTTCGTCGACCGCGTC
GCAGTGCTGGATTGGAAGAAGCAAGTGCTCCGGGCCATGACTCCGACCATCAAGAATCCAAGAATGAAGACAATGATGATGATGACTC