Description :
From Genome Similarity Track
Location :
Scaffold_45:22442- 23587
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_45-snap-gene-0.45Protein kinase

Sequence
1145 bases(100 bases per row)
CGAGACTGCACGCCATGATGCTTGTGACTTGACTGAAGaTACAGCCGAAACGgCAGTCCAGCTCGAGGGACTTGACGACTGATCACTCGCGTCAAATGCA
CTGAAGTCAGCCCAATCGGCCTCGGCAATAGGCTTTGCTGACAAAGATCTTCGCATACTCATGCTCCGACGACTGACACGCCCAGATCGCAGTTCGTCGA
CTCGATCGAGCACTTGATAGATTGTCGGTCGCTCTTCAACGTCTACGGTCAGCATCCAAGTGACGAGAGCTACGAAGCCAAAAGAGTATGCTTCCCCGAA
GCGTACATTTCGAGGAGGAAAGCGCACGTTGCCACTGAAGATCGCAAGCTGCTGAACGCCTTCGGTACGATTCTCAAACGGTGAGAATGGACCGAACGCC
ATTGtATAGAGgAGACATCCAAGCGACCAAACATCACTACGACCATCCACTTCACCACGGAAACGTGTAGTAGAATGCGCTTCCCACAGCTCTGGGGCAC
GATACGCCGCGCTGCTGAACTGAACAGCTCTTTCGAAGAGCTCAAGTGCATCATGGGAAGTGCTGATCATCGACTGAACTGGTGCGACAGAGCCAAAGTC
GGTCAAGATGGGTTCGATCGGCTCTGTCGAGGTCAGGAGAACGTTATGCGGCTTAATGTCACGATGGACATAGCCACGAGCTTGTAATTCCAGCACGGCC
TCTAcGAGAAGCACGAAGATGCGCAAGCACTCGGACTCTGAGAACGCCGCACGTTCTGTATATTaTCATGTCAGTTTCGTTACGATCACACCACAAAGCC
ACTCACGCACTCTCCTCGAAGGCTCGCTCAATATGCGACTGTAGTGATCCACGCTCGTACAGAGGGAACACCATAAGCACTTCTTTTGTTTGCGTATgTC
CCTCGACGACTCGAACTTCCGCCTCTACGAGGCGCATACTGTTGGGATGCTGCAGTGCGCGCTGCACTTGGATCTCGAGCAGCACCCGCTGCAACTGCTC
CATGTCGGCGACGCCGCGCGTCCGTTTGAGTGCAAACTGAGAGTCGCCACGACGCACTCTGTAAACGGTTGCGAAGCCGCCGTCCGCTAGCAAGCCCTCG
CTGATGTACGCACGACCATTGACTCGCACCACCGCGTTCCCCATG