Description :
From Genome Similarity Track
Location :
Scaffold_11:224413- 226687
Transcript NameFunction/comments
Phyke_g1539hypothetical protein PHYSODRAFT_286400
Phyke_g1540conserved hypothetical protein

Sequence
2274 bases(100 bases per row)
TCGAGGAGTAGACTCTGTCACGGTGACACGGTGGCTGGTTCGCAATGGACTGCAAAACGTACGAAATGTTGATGGAGGGTACACTGAGTACGCAAAAGAT
GGCGGTGTAGACCCGACCTTCCCAATGTATTGAGGCttcagcaaaaaaaatgttgctgcatctATAAGCTTTGTGAAGTATTTTCAGTCTCGACATGAAG
TGTGGAGGGAAAATGAATCTTTATGGATCCAGAATACCTTCGTGCATGGAGAGGTAGTCCACATTAGTGCGCTCGCGGCGGCTGCGTTTTGCATTCGCTG
GTTGGGATACGTTGTCCTGTGTCGCACTCACAGTAGTGGGGGACGATTGATCGGATATATCGCCGTCAGCTTTCTCTTcgtctctttcttcttcacttcc
cTCGTCCTGATCTTCTTCCGCAccgtcctcttcctcctcgttaccatcatcatcactctCGTTTTTGACTTCGAAGGtctcgtcatcttcactgTCCTCC
CCTTTGCCGGCAAACAtgagctcgttgagctgGCGATAATCTACCTCGGTACGTTTGCGCTTTCCACGAACAACCAGAGAGGAATCCCCGTCCGCGTCAT
CGTCATTATCCGCACTCTCATTGTCGTTcatttgagctgctcgagctATGGCAGCATTAATCTTTTGCCCCGTCAACAGTTCCGAAGTACCGTCACGGTA
GTCCGCACGCCAGCGCGAATACTTTCCCGAGGCCGGTGGGTGAAACTCGACAACGACCCCGAGAATCAATTCCTTTGTTTTACGGTCGATCTTAGCAACT
CGCTCGCCCACAATACCCTCTTGTTTACCTTTCTTCGGCACTGTAGCCTGCGACCCCACTGAAACCTTCGACCGCATAGACCGCCTACAATGCGCATCAC
AATCAACAAAGAAAAGTAAGGCGTCATGTGAAAAAATAAATGACAATAAAGCCCCACGCACTGGTTAAGATCAATGACGTCGTCTTTGTGGAGATATTTC
AAgtcgtcctcgctctcgGACACCTCGTCCGCTaactcttcttcctcgccaCTGGCTTCTCCCGGTGCTCGCTCATCTGAGCTGTCTTCACCATCGccct
cgtcttcgtcgttaTAAACAAaatcctcgtcatcctcttcatcatcgtcatcaccatcaacagTGGCGCTTCCATCCTCTGGGTCATCATCGGCAGACTG
TATGGGGCTGGTGGAATCTGTCACCACTTGTTGCTCCTCCAAAGCGAGCCGTGGAAAAAGGTCGTCGACGGACTCGTAGGTTGTCCCAAAGACAGAATTA
ATCGCTTTAAGGCATTCGAAGATAGCTAAGCAGACTTCGCAGAACCAGGGTTCATCGCCTGCCGGGATATTTTCAGTCAGCACTATTGGAGTTTGACACT
GCTGGTGATACGCACGATGACAACCGACACTGTCACAGAGCAAGATATCATTCCCCTGCTCGATCTCGGTCTTCCCGCAACGAGAACAATGCACTTCTTC
AAATACTGCGAGCGGGGGGACTTGCGGGTCATTCGCGTTTAGAGCCTGCAGTTCACGCAACCTGTCGACAAGGGCACGCTGGCCAGTCGCAATCTTGCGG
TGAGCCACCTCAATCTCCTTATTGGGTTTGAGTTTGTCTTGACTCGTGTTACGCCATCCTTGCGCTTCGTAGGCCTCTACAAAGGCCATTGGGTAGCGTA
ATCGGTGTGCCTAGATACGAATGTACCAGGGTTGGTCAATGGTGCCTACCGGAGGAGCATTCTGACAACAGTACCCACCTGTGCTCTGATCTTAGTCTCC
ATACGCTTGTACTCTGGGCGAGAAGGAGGTGCAACGGTATCACTTTCAGCATCCGGGCTGGGATCTTTCTGCTTCCGCGGTGGTCGTCTTGGAGTGCTGC
CAGATGTCGGCGTAAATGCTGCGGGTGCTCGACGCTGGCGTTGCTCCCGCTTTTCCACCGGTGCTTTACTGCGTTTGCAATGAAAGCACAAGCAGAGGAA
TGAGTCATGTTATATTCGGAACAGGTTCACACATAGAGTATATTGATGAaagagggggggggggggggggggtatCCTGCGTATTTCGTACATTGATAGG
CGGCGGCGACCTGAACTCGATGGGGCCCagtcatcgtcgtcagctTTCGACGAACGGTCTTTCTTCCTACTGCTTGGCATTCGCAGCGGATAGTGTTTTG
ATCGCCTGTCTAACAATAACAATTTTAGTGCTAATTCATTGAAACCAAACTAGTGATGGTCTAAGATGGCTATT