Description :
From Genome Similarity Track
Location :
Scaffold_70:224380- 226942
Sequence
2562 bases(100 bases per row)
CCGTAGGCATTCAAAGGGATTTACATATAAATCGACCACGATTTGGCGAGCTCAAATCCCTTGAGAACGGGTAATATCCGGGCGGCCAAAATGCGTGGTG
AGCACAATACAAGTTTGAAACAGTACTACTGTACAGATAAACCTGGCATAACTGATACGACCCGTGGACGACAGTCGTATCATGTATAGCAATAGTGTCA
TGTGAATGTGAGTTGTGGGTAAGATTTTAACCAGTTCATCATAACGAAAGCCCATGTAAATGCTGTCATCATCATCATCATCAAGTGTTGGAGGCAAGGT
TTCCAGCTATAGCTGTCTCTGCAGTAGCAATCATTATCACTGATATGTCGAGCTCAACGCACAGCTTTGTGGCTGGTGCATAAGTATGGATAGCTTGAGC
CTCAGCCCAATGCTTTGCATCTACTGAGCTCTAGGCAAATAATGCATACCAGTGCTTGTGCTGATATTCTATTGTTGCGACCACAATATGATCCTTGCTT
ATGTTATGCAGTGTGCAGGTCTGCTGTCACAGAATGCACGTACAACGGAGACCGCAGAGCCATGGGCCAGTGCAACAGAGCAAGACGAACTCACAAAATA
AGTATTACAACTGAAAAGTCAGTAAACATTTCTTAAGCGACCACCGATCGGAAACTAGACGCTTCTCCCCGAGCTGTTTTCTTGGTTCAGCAAAACAACT
ACACATATCAATGCTCCCGCCAGCCTGGTGGTTAAGATACTGCACATTCAAATGCCCCCACTATCGGGATAATATATCAAGTACATGACAATCAACTTAT
TGAGTAGCCCTACGCATCACTGCAAACGTCTTCCCTCGTAGTTGGTATCACTAGTAGTGATGTAGAGAGAAGCCTACTTCTCTCTACATCGCCTTCCTTA
CAGTTAGCCGCATCAGCCTTTCGGAATTTATATATTATCTGGGAAAACGACGTCTTTATATGTACTCATTGTTTCCAAAAGGACCTATGTTGACTAACTA
TACGTCACACGAATGACATCTTAGTGTACGTGTCTTATAACTAAGGAAGCCTCTGACGATCTCGCTCAAGCCTGAGGTACACATTAAAGTGCTTGAGCAC
ATAACTGTGGGTATGTGCTACTAGTCATCAATCATTGAGCAATCTCTCTCTCGAATGCTTTACAACATCCACCAGCGTAATCTGCAGACTGCAAACGTTT
CTGTTGCCAATAGCCCTACATGTACGTGCTGGTCCGGCTTGGCGCGGTACAGTAGGCCGCACGTCCAGGCGAAGATGCTGGTGATCGAGGCACTACGCCA
CCATGTCCACTTGAGGCTCTAAATGTAATACGAAATGTATTGACCAGAGCTTTCGGCACACAAAACTCGTGCTTGGCATGTCGTCTACCCAGCAAAGAGG
CAGATGATATCCCGAACGGGGAGATAATGAGCTCTACTATTTTTTTTTAATTTTTTTGCGGTTACCGCCGGGAACACTCGGGGCGAGCACTGCGTCAACC
CCGCTTACAGGGCATCCCACCTACAAACTGGCACGATGCGCAGGCGAGTGTTGGTAGGAGAAAGAGCTTAGTGAGCAGGAAGGCGACCCTAAAAACACAC
GTGCTTTTCACTGAACAACTTTGGGATTGAGGTGGGAAAAATTCGAAGATGCCAACCCCCTCTGTGATAGCTGCAAACTACTATACGCCAATGGGCTCAA
TGAGACGCGTCCCGTATACACACAAGCAAAGGTAACCTTGGGCGGCCCAGGTGTATACTGTATAGTCCGGCACGCTGGAGCGGAGCCAGGGTCACTACCT
TCTTCGCACTCCCCTTCGTGACACTGGCGACGATCATGGCTGCTTGTTGCTCACGCCTGATGGCCTTCGTCAGCACGAGCTCGTTTTACTTGAGCTCTCC
TACTGCAGGCACTGGCATCATATTCAGGAGCGGTCGCAGCTTCTGGAATTGCGTGGGCCCAAGAGGCTTCGTCAATATGTCTGCAATCATCTCCTTAGAT
GGGCAATACTCGATAGCAAACACATCTCTATCCACGTAGTCAGGGATTTTGTGGTACTTCAGATTAATTCCTTTGACCTTGTAGTCCCAGTGTTTACCGT
AATTACAGCGATATCAGCTTGATTGTCATCGTAGAGAATCGTCTTCTTGCGGAGCAATCCATGCGACCTTACAGAGATTGTGAGTCCACAGTATGATAGT
TGCACACTCCGCTGTAGCAACAAATTCCGAGTTGCATGTATCATCTCTAATGCGTCGCTGTTTGTGGCTCGAGTATGCGTAGGTGCAGCCCTCCATCTGG
AGCACAAAACCAGACACAGATCGCCGATCATCCTTTTCATTGCCCAAATCCGCGTCTGCATACGCTACAACTTTTAGATCTTTCCCGAGGGTCACCATGC
GTCCACGTAGGCCGCAAATTGCAAGTCGGGCTGCTCAGATCGTGTCCACACTAGACCGTAATCCGTGGCCCCTCTCAGGTACCGAAGCACTCTCTTTGCA
AGCACGATGCGCTCGTGTGTGAACCAATTCAGGAGTTTCCCCAGCGTCCAGACGGCGTTTGC