Description :
From Genome Similarity Track
Location :
Scaffold_1:2243142- 2244545
Transcript NameFunction/comments
g686.t1RAW31713.1 hypothetical protein PC110_g11933 [Phytophthora cactorum

Sequence
1403 bases(100 bases per row)
ACTTAGCTAACGAGCCTTCTACCAGCATATTATAACTTTTGGTACAGACACCCCCAACCGATAAAAGAGCGGCAATCAGCTCGCCAGCCGGATCACGCAG
GTGTTTTCACGTAAACTGGGTGCCGAGCCAGAACGCAAAACAAGAGGCACTTCAATCATTAGACCATACTAGTACTACTGTACCTAGCAGTTGGTGGACT
GTATGGACGATCACCATCATACACGTAACGCTACAGCCAGGGATGTTAATTAAGCCTTCTTTTTTCCTGCTATCTCCTTATAATGCAAAAGAAGATCGGT
CAAATCGGCCGAAATTCTTCTTTATAATGAGAAGTCCAGCGTTTGCTAAGAGCTCGTGGCGACGGTATATCCCGGATATCTCGGCCAAATACTGAGGCAC
TGCTGTGTCATTTTCTGTTGGAAATGGGCGTGAACGACAAGAACGTACATGTACTTCGCCACACAGCTCCTCATGTCAAAGCTATTAATACGTGATAGCG
GAAGATGAATGACGTAAACTTCAGATATTAATTAAGGTCAAGAAAAGATTTCTTTTTTAACATTCTGGCAATCTGATAGACATAAGAAGATTTTGTCTTT
TCAGGAGGCTTTCTTTTAACATCCCTGGCTACAGTTGAAGTGAACATTGCCTGATAACAGCAATGCTTGGCAACAATGCATGCGAGCCAAAACTCTACGC
ATTAAACTTTAAATCTGCAAAAGTGCTTGTTGCGTTACTACGTAGTATAATTTATCTCTTAAAGAACTTCATCGCTGACCCGAGTTCATATCTTAGGGCA
GAGTAGACGTGCTTTGCTGTACTGTCTCGATTGTGCTGCAGGCTGCAACACACACGAGTGCATTGATGATTTTAGGGAAACTAATGTTTTTACTGTCCGG
AGAATTTTCGTCCTGCGTCGCGCGCGATATATGTGCAAACGCTAGATGCTGGGTACTAGAAACTAATCTTAACCCTTACTTCGGGTTTAGTTTTTCAGTG
AGGTACATTGACCTCACTTAGCTATGCTAACGACTTCCTATGTTCAATTTTACCTCGGGTTATTAGCCAGTTCTAGCGTAGCATAAGGCTAATGCTACTA
CATGTACCATTACTCATTTTCACGTGAATACTAGCTGCAGGGGCTAATCTTTACTGGTGACTTGCGATACATGCACAGCTTTCGATTCATATATACACGA
GAGTAACGAGCTACTTCAAGTAAAAACAGCCTTCCTGGTATTGAAGTCTTCCAGCGTCGTCAAACCTGTTCTTACTGATTCGGGATCAGCGGAGTTTTCT
CGGTGACCACCTTAATCTCTATAGGAGCCTCAAGCTGCGGTATGCCAGGAGATCTCATGGAGCTAGCAGTTGCAGATTCGGCGGCCTGTTTCGAACGACG
GCT