Description :
From Genome Similarity Track
Location :
Scaffold_202:22431- 25431
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_202-snap-gene-0.20Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_202-fgenesh-gene-0.10Dimeric dihydrodiol dehydrogenase

Sequence
3000 bases(100 bases per row)
GCGTACCTCGCCAATGTGTGCGGCCTTGCTGTGATGGCGAAAGCCAAGCACCCGAGTATTAATCTCCGGCTCCTAACTAGTGGATTTGATCGCAGTGAGA
GAACGTGTAGCAATCTCGTCGAATTTGGGTTCTCCACCAAGAGCGCCAGCGTCAGCGAGTGGTGGGGCTGGGAGAATGAGCCCCAGGATACGCGCATCGA
TGACTTTATCGTGTGTCGCGGCAGGTTGTTTGGTGAGGGCACTGCGAGGGCCGTCCATAGTGACGGCGACTATGACGACGAGGAGTATGGAGACTATTAG
TTGACCGCCTCACTCGAAAGGACGGTGGGATACTAAGGAGATACGCGGCGACGGGTTGATTGGAGGGAACACCAGCAGAGCAACACTTGCCGACGTAGGC
TTCTAAATGAATCCGTTACCATTTACCAAAGTCATTTCAACCACTCNNNNNNNNNNAAGGGGATACGCGACGACGGGTTCATTGGAGGGAACACCAGCAA
AGCAACACTTGCCGACGTAGACTTCTAGGTAAAAGAATCCGTTGCCATTCACCAAAGTCATTTCAACCACTCCACTCAGAGAGACAGAGTGGAAGTGGAG
GCAGTAAGGTCAGCTATCATACCTTCACGCTGACGGCTCGTCCGAGTCGTACTTGANNNNNNNNNNAGGAAGTCGAGGCAGTAAGGTCAACTATCATACC
TTCACGCAGATGGCTCGTCCGAGTCGTACTTGACCCCGACCTGGCGGCGGATCTCTTGCATGAGCGTCGCGACGCCGATCGCTTCGTCCAGCGGATACTC
GTCCATCTCTGTCTGCTGGTTCTGGACGGCGTTCGTGATGGCTGCGGCCTCGTACACGAGTCCTTCCGACGTGGAGAAGTTGTACACGGCATCCGCGGCA
CGCGGCGGCAGCGGGAACACGGACGTCTCCACGATACGTGGCTCTTTGAACAGTGTGAGCGAGACTTTGGTCGGCGCGTACGCTGGGTCGTGGATCTCGA
TACGCCCCAGCGTGCCGACAAGAGTCACAGCCGCGCCCATGTTGGCGAGCAGCGTATACTCGACTGTCGCGAATCGTTGGCCGCTGTATTCGAGCGTCAC
GGTCGAGTACGCGTCGACACCGTCGGGCGTGAGTCCACCCGTGGCCGTCACCTTGACTGGCTCGGTCCCCAACGCTAGCGTCGCAAACGTGAGCGGGTAG
ATGCCGATGCAGTTCAGTCCGCCGCCGCCCATGGCACGGCTCCAAACCGACGCCACGGAAGTCGGGAACGCCACGCCCATGTGGGCATGGACGTTGCGCA
CCTCGCCAATGCGCTTCTCTTGTAGCAGCGTCCGAACGAACGCAAGCGCGGGGAAGAACCGCGTCCACACGGCCTCGACCAGCACGCACTTCTTCTCTCT
CGCGAGGGCGACGCATTGCTGGACTTGGGAGGCGTTCATCATCATGGGCTTCTCCACGACCACGTGCTTGCCATACGAGAGCGCGAGCATCGCGGCGTGG
AAGTGCGTGATGTGCTGCGTGCCGACGTAGACCACGTCCACGGCGGTGTCAGCGCAGAGCTGCTCGTAGGAGCCGTACGCGAGGGGGATCTTGTGCGTGG
TGGCGAACGCTTGGGCGTTGGCGAGCGACCGCGCGGCGCACGCGTGGAGAGAGGCGCTCGGGAGGCTGGCCATGGCCGAGACGAAGTCGTGCGAAATGCG
GCCGCAGCCCACGATGCCCCAGCGCACAGGAGGGGCCATGACGGTGATTGTTGGATTTCGGGAACGTTGGTTTATTGGATTGTGCGATCGTGGTCCTCAT
GTGGATCTGCACCAGGACCACCGAGACACCGAGTTGGTGTTGGGAATCCGTTGGTCACCAACCAGTTCCCAACATGGGATTTGCGCCGTTTCGGATTGTT
GGGTTGGCGAGTTTCAGATATCCGCGGGAAGCGACCGGATTGGTTGAAATAGAAGTTGTTGGTATTTTCACGGTGCAAGTTGAAGTGACTCACATCGCGA
GACAGTGCAGAAGATCGACGATCACTGGTGCTACAGAACAGTGCAGTGTTCTGGAGCAGTGCACTGTTCTGGAAGTTTGGAACAAGGTCATTCCACCCCG
AATGCTGAGTGGAACGAGTTCGTTCTCATATTGATCTTGCACTGTTCACCGCAGAAGTACTGCCAGAACCAATCAAATCTTGTAGGTACGTACCGTGTAA
CAGCGCTTCCCGACACCCAACCCGTATCTAAAGATCGTAGCTGTCCACAAGAAATGATCCACCTCTGCGGACACATGAAGATACGAGGAGGCACGCCATA
GAACAAGGAAACATTGCAGTGAAACTCTCAATATTTTGTGGACTGTGCACAGTATCCTCGTCGCCTTTCACCTCTTCTTTACTCATTCGTCGACTTGTTC
CGTCGTCACCTTCCCGTGCGACTGGTTTCATGCTACAGGTGATGATTCGTTCGTCTGACCTGCAGCCATCATCTCCTACGTGCGAAGATTTCACATCATA
CGTTCCTACGGTTGGTGTGTTATCAGTCTGCACTGCAACGGTTCCCCCAGAGTTCAGTGTGGAATCTCCACAGTGGAACTGCTCTGCAGGTTAAACTGCA
GAATCGTTCCGACACTTTTGCTGCACAGTGGGTTTGCATCACCGACCCCACACCGCAAATAGCCATTCTGTTTGCCAGTCATGAACCAGAGACGACGGGA
TTTCGAACGATCACCTCGGACTGGGGGAGCTTGGCTCAAGGTCTCGACGAAGGACTCTCCAGAATGGAACCAGAGACAGACCAGTCGGAGTGGTACACAT
GATCCGTNNNNNNNNNNAAAGGACTCTCCAGAACGGAACCAGAGACAGACACCAGCCGGAGTGGTACACATGATCCGTCCACGCACTTGATCATAAGTGG
AACTTTCAATGAAGTTCGCTCAACTTTTAGTAAAAGTTTTTTACTCATCTCATTAGCTCATGGAGTTCTCTGATTTAGCAACCGACGAATGTTCAACCAG