Description :
From Genome Similarity Track
Location :
Scaffold_1268:2243- 4403
Sequence
2160 bases(100 bases per row)
TCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGAAAACTGCAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGAT
CCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACTTCA
TCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAG
GAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTG
ATCCCGCTACACCACAATGGTGCGCGTGCCCGGATGTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGG
GAAGAGGCGTCGTCGGAAGTCGAATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAG
AGGTGGATCCGGATCCGGATCTAGAAGAGAAACCACTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAAC
AAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACTGTACCTAAACCCAACCCCGCTAGTCGAAGAAACAAGA
AAGAAGACGAAAACGAGTAAGACTACTCGGAAGAAGATGCAAGCTCTAGAGTCGGAAAAAGACCAAGCTGGATCCAGGTCAGGCTGGTCAGACAAGGATC
TCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGGCATGAAGATCCTGAATCCACGACAGATCGAAGATCCAAGAGAACC
GGTGAGAGCACCAGTGAAAACGGCGAACAAGCTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGAAATCGTAGCTGGTGTGTTCGACGCA
GAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAAGTCCATCTACCGGAGAAAAGAGGGGGGGGGG
GCCCCACCGGGGGGTTTCCGCGGTGCCCCCCCGCAGAAATGGGTCAGAGTGGGTTCCTCGCAATAACAAAACGCCCGCTGGAGAAGTATCCAAACACTCT
TCCCAACCCCAGCAGACTTAGACCTCCGGTGCATCCATGCTGGAAGCGCGGGCGAGATCCGAGACGGAATCCTGTGAGCGTGAAGGCTCGGGATCCAGTA
GCCCTACGCGTGATCTGACACAATCTGGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCGGGCTCAGGTAATCGCCTCACG
GATCCGGTCTCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTCCTCGGGCACCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCTGGCCG
AACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCGTGGAGGAGACAACTCCATGATGAT
TCGACCCGATGATCTGGATGGCCCATCACTCCTCAGCATGGTAGCAACAGCCGCAGCCGGGGCGGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCA
GCCATATCGGTTCTGAAGGAGTTCACGGGCAAGGATCAAGACGAGGACCGAGCGCGGACATGGATCAGCAAAGTTAAGTCGGCCCTCATAAGAGATCAAG
CGTCGGACGCTGAGAAGTGTTTGACATTTGCGGATCTGATAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGAAACAAGTGGCC
AGATTTGCTACGAAGTTTCCAAACCCAGTACTGTGGATTGGGAGTGTCAGTGGCACGACAATACTACCACGCTCGCCGCAGATCGGATGAATCCCCGCTA
GAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGA