Description :
From Genome Similarity Track
Location :
Scaffold_182:2243- 4065
Transcript NameFunction/comments
Phyta_totarag5189hypothetical protein PHYSODRAFT_484119

Sequence
1822 bases(100 bases per row)
TGGATCGTGGTGCTCTTCTTGCACATTTTCAATACGATTTACTCAATTTCGCTTGCGTATATCTACCACTATATGTCGTCTCCAGATATGGAATACTACG
TGCAGTTGTTACGGGTGATGCCGCAAGAAAACTACAAAGGAATAATCGCCCTGTATGCCTGTATCGGTGCCATGAACTTCTACAGCGCCTTGAAAATGTC
TGTCTACTCGTTATACTATCGCCGACTGGTATTTCGCAAGATGGCGGATGTAAGCACTGAAAATGAAGCCGAGGGTGATGCTGATCGAAATGAAGAAGTG
GTTGATATATCAACAAGGTTTCGAGCATTAAAACGCTTCGCTGCTGGATTTGCACGTGCTACTAGTGCTCGTGGCGAGTGGTTCGACGTCGTTTTGCTAA
TGAGAGAAGTAACAGAGATTTCATCTCAGACCGTGCAGGCTTACTCGTCTAGCTTTCTCATCAGTAGCGTGTGGATGAATCAAGTGTTTGCAGGACTTAT
CTTCGTGAACACAATTGCCAACACACTTGTTCACTACAACTTGGAGGAAAAAGTGGGCCTAAGGCGGTTGTATAGCACCGCAATTGACCTGGCACTCGAC
TTTGCGTGGGGCTTCATCATTCCCGGGAAGATCATATTTGTCTACATATCATTGTTCATAGCGAATCATAGCTCGTTTCCGGATGAGTTTAACTACTCCG
ATACACTGCAGATAAAGGCGATCCTCGAATACAACCAGTTCTTCATGGTCACATGGTTGGACGCAGTCACCACGACGTTGCCTTACTTGAATATGCTCTC
GGGTCTGCGAAGCGTAAAGTTTCTGATTCAGCACGATATGGAAGCAGTTCATGTTTTATCGCCCGCGAAAGTCCAGCCTGTAGGACCATTAGTACGTCTT
GCAAAGCTTACAGCCATTATTGAGCCAGACCAAGCTCCAGTCCTAACCCAAGAACCAGCAAAATCTCCGAATTCGGAGAAACACCAAGTTGAAAccaagc
acagcagcgtaTATGTAAGGGGGATCACAGCAGGTGTCGTGGCCCTCATGCCTCTCTGCGGCGTGTTTGTCCTTCTCACATCCATGACTTCATCGGGAAT
ATTTTTTGGCGAAGAAAACTCTTGCGCAGTTGGTTGCAAATTGCGAATGCATCCGTGGTTCACGCGACAGTGTGCGTGTTCTGTAATGGAGATGAATTGT
TTCGAGAGAGGTATCACCGGTCGTGAGATAGAGACTCGCGACCTTCTTCAGTCTCTCGACCCCAAAGTGCTGAACTCACTTATTATCTCACATTGCGCCG
AGCTTGTCATGACCGAGGACATTCGTCGCTTTAGCAACCTCATGGCTCTCGAGCTGTACAACTCAACGGTGGTTGACTGGCCCGCTAATGCGTCCTTGTC
ACTCCCGTTTGTTCCCTTTCTCACTACGATATACATTGTGCGATCTCGACTCATAGGCGGCATTCCAGCGGGCTTGACGACAGATTTGTCGCCGAACGTC
CTGGACGTCGAGTTCGTGGCCACTGACCTCGGAGGGCCGTTGCCAGACGATCTCGACGAGATGTGGCCGGCGATTGTGATACTGTACTTTGAGCACTGTG
GACTGCAGGAATTCCCGTCCGCCATGGCAAGGATGGCCTTGACGGATTTATCCCTCGTGGACAACAACATCTCGGTGCTACCCGAAATCCTGAGCGACAG
CTCCATGTACATCATGTTGGATCGGAACCCGCTAGAGCAAATCCCCGACGGCTTCGAGTCTCTGGACGACCTGCACTACTTGCCGTTCAGTACACGAACG
TCGCCTCGTTGCCTCAATGGCT