Description :
From Genome Similarity Track
Location :
Scaffold_2:2242902- 2250822
Transcript NameFunction/comments
Physo_258045Hypothetical protein

Sequence
7920 bases(100 bases per row)
ATTGGCTAAAAGATGCTGCTTTCAGCCAATAGGAATCCTAAGTCTCTATGGACCATCCGTCGTGGTGGTTAGAATATTACATTTAGAGGACGTCAGAAAC
ATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGAGTGTTTATTTAGATTAATCTACACTCGGAGGCCCGAGTATAATTAACTCTA
ATCGAAACTAGGCTGCGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCC
GTCCAACGACCGACTACCTGAATTCGTACGTCATCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGTCCATGAAAAGCTCCACTACGC
CTGCAACTCACGTTGCACGCGCTGACTGTCCCCATCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTGTTAACAGTCATTGGTGAGGCGGCTGTAGC
TACGATGCTGCGTACGCTAACGCCGACAGAGCAACATGGTGTTGCTCTGGGATTCATCATGAGGGAGCAGCGAGATGCTTCTTCGTTTACCACGGTGTCG
TCGGGGACGACACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTACGTTGGAAGAGAGGGCAAGCCTCTCCTCCGTTGGCTTGTCGAACTCGACA
CTACCATTGCGGCTCGACCCATCGTCGACCCGTTGCCGAAGGTCGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACGCCG
ACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCACGGAAGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGTGGAG
TTCCTCGACCTGCAACAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGGGCACGGTATTTGGTCTCGAACATCGTGACCAACCCGATCGACGAGGCGA
CCAAGGTCGTCACGTTCATGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATCACTCTTGC
AATGCAGGAGGAGTTTAGCCTCCGGCAGGCTAAGCTGCATGCACATGTACCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATG
GACCTCTCGAGTGCTGCAACTACTGGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGTCACCTTGCACGGGAGTGCA
CGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAGCTAAACCAAAAAGGCTGGACGCCAGTAGGCGCGGGGCGCCCTACT
GGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCAACACTGAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAACCAAGATGATAGGCCTA
ACCTTGTCATCCTGATCGTGGTATCAATGAGGGCAAGCGGCTCTCTTCGTGCTTTGGTAGATTCTGGCGCGTCGAAAAACTTTGTTCGACTGCGAAGTCT
ATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAGGTACGTCTGGCAACGGGTACCGTCGTGAAGACCGAGAAGCGCATGGTACGC
GTGCGCTTCACGTATAAAGATCAAGCGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCAC
GACATAATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGATAGCGGAACAGAGAGCGATGGCCCTGTTGCCGCAACGCGCGCACC
TGTCGGTGCGCGCGACTCCCCACTCGAGACAGCGTCTAATGCCGCTGTCCCGGAGCACCCTGGGCGCGCGCGAGTACGCGCGCAAGAGCAGCTAGCGTCG
GCGTTGCCGCCGACAGCTAATGAAGGAAATGTGCTGACCTTGGAGGTCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGGCCCCGACGGGTGCGG
AAGACGCAGGCAAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAAGCTGATTGGATCAGTTTTGGCCAATGATAAGAGCCAAGGTGATGTAACGCCGTC
GACTCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCTGTAATGGGGGTCTCCGCCAATGGATGGTGTCGAGGT
ATTGAAGGCGCGTCGGTTCCGGGAACCGACGCTGCGAAACGACAGAGACACTTCGCGTCGACTCCGGGAGTCGACGCACCCTTTGTAACGAAGGGCTCCG
CTAATAACAGAAGACGGCGTGTCGGCTCCGGGAGCCGACGTTGCAGGCGGTGCGGACGGTTGCAAACGTACCGCACCGGAAAAACTTGGATGCTGTCGTG
CACCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCTCTCGCCCGCGGGACGAACCCGCCGGCGGTACCGAAGAATAACACCCGTC
CACGGCTGGGCCTGGACGAGGTCAAGAGTCATGCGGAGCCGGGCTCCACAGGACAAGAAGACGGCGCATGCGAAGGTCGCTGCACAAGTCTCGGCCTGGG
GCCGAGACGCTACAAGAAATGTCTCCCGGGCAAACGGAGGCAGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGATTCCGGT
ACAGGGAGATGACTCTCGCTAACCTCCCGACGCAAGCGTCGAGTTGACTTCGCTTCCAGTCATAGGCTGGAAGCGCTTCGCGCGTGACTTGCATGATGGA
CGTATCCAGTAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTTATGGAGACCACCACTGAGAGCGAGG
ACACTCTCATTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTGAAGACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGA
CGTGCTTCCGGAAGAGATCCCTGCGGAACTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTCCCGGGCACGAAGTACTGTGTCACGCGGCAG
TGGCCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTC
CGACGTTCTGTGTCAAGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCG
AAAAGATGTCATCATCGATTCAATGGCCAGGAGCACTATCTATAGTGCTCTTGATCTGCGCGATTGGTTTTATCAGATCCTCATGCGTGAGAGCGATATC
CCTCTCACGGCTGTGAGCACACCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGA
CGCATTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGATACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCA
CAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCACAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCGTCGGAGCGAGCGAG
ATACCCGTGCTCGGGTGTCTCGTCGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACACCGTCGAACGTCAAGG
AACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTTCTGAAGAAGGACAC
CGAGTGAATTTGGACTGTTGAGTGTCAGCAAGCCTTTGATGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCGCGTTGTGT
GTGACGCATCCGACTTCGAAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCTACTACCAATCGCGTCGGCTGAAGCCAGC
TGAGCGCAACTACCCGGGATATGACAAAAAAACACCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCGAACTGTTCGTGGT
CTATACGGACCACGCGTCGCTGCGGTCGGCTGTGAAGTCGCCGCACATCTAGCAACGGATGGTGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGG
GTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGTCTGATGCCGACGTCAATGCCATTGACGCCA
TGCGATCGAGCACCCCAACGTCGTCACTGTTTGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTATGGCTGAGCGCC
TTCTAACAAGGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACATCGTTATCGGGTGCACGACGGCTTATTACTCTACAGTGCAGTCGACGAC
AACGCGGACCGCGTTGTCGTGCCCATGACCACGACCTGCGACTCAGGATCATGTACAAGTATCACGATGCACCGACTGCGGGACATCCGGACCGTGAGAA
GACATATCTTCTTCTCACGCGGGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGAGTGAAGCCT
GCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCACGGGAGTGTTGGTAGTCCATGTCTTTGGACTTCGTATTCGGACTTTACACTTCTTGGG
AGTCAACTTTCGATGTCGACTGCGGATCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACACTCCCT
CGTTCCAACACTGGAGCGAGTGTCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCAT
CAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCGACGCAGCAGCCGCAGAAGGCCGCTGAC
ACTTGCACAGTGTCAGCCACGACTACGCGCAAGAAGAAGAAGAAGCACGCGTCTGTTCAGGGCACAGACGCCGACAAGAGCAAGAAGAAGAAGAAGAACG
GGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCGT
GCAGAGCAGACAAGCCGTCATTCGGTTTGTCGAAGACGCTATCGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACT
AATGAAATCAAGAAGGGTTCATTGGTTTTGTTAGCAACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCA
TCGGGCCGTTCACGGTATTGACACGGCCTGGCAACGCCAACACGCTAGATATTCCATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGGTGGCTGAA
GCCATACCGGAAGCACGAGCCACCTAGCTCGGCTGGCCCGAAGTGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAGCGCGTGAACGCGCTGGTCCAAGC
GTGCGACGCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAGGCCTGAGCAACTTGAGCCCTCAGGAGCGCCACCTCCTGCTTCAGAGCGGC
GAACTCCCGGCTCTGATGCTGTTCCACAGCAGCGACCCGCTCCTCGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACC
ACCGCCGCCTCCGATCCACGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACCATAGTATCCCGAAAACGAACCGGCAGCCGGTTCGT
TATCGTATTCGTTGGAGAGGGTTTCCGCCCCCACCAAGATACATGGGAGCCACGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAA
GCTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAGGTCCCATGATCGCCGCGTTCCTCGCGTGCCAAGAACTT
GGCACGAAGATCCTTGAGACTCTCAGGTACACGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGCGCGCCGCACCCGGAAGGCACAACGTGCAC
TGTTGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAGCCGCCCGCGCGTCGAGAATGTCTCGAAGCGCTCAC
GGGCATGCTTAACCCGCTCGCGGTAAGCAGCCGGTTGCTTGTTGAAGTTCTCAACAAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCACTTT
GCTGCGAGAAGAGGTCTTCTTGCTGGAGAAGTACCGGAGCTCGTGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGAATCGTTAACGGATCAAACTGCTGC
TCCTCCGCAACAGCATCGTCGTGGATACCGCTGCATACGTACAGCGGGATTTCGTTTGGAGGCACAGTGTTGCCCACACGGTCTGCGATCTCTGACGCAG
ACGGCATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCAGAGAGCTTGAAGGCGCCATTTCACGCGGGGAGCTTAAAGCCCCAGAAGCAGAGAGCGGAGT
GTCGCTCTCGCCGCGCGAACGCTTCGAACTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCGACCCGCATGCGGGTCGAGACTATCGCTGTCGA
TAGACTCCTTGCACTTGCTAGAAGAGGCCTCGCCCTCTTCCATCTCCACATCGTCGTCTTCAAAGTCAACGGCGTCTTTGACTACAGAAGAACCTTCGAG
GACAATCTCTGGTTGAGTTGTCCCCGCCGCAGCCTTGGTAGCAAGAGCGTCACGCTTTGCTTTGAGACGCTCGCGGTACTCGGGGATAGAAACGCTCTCT
ATCCCCGAGTACCGCGAGCTCGAGCTCATTCCGCAATGAGCTCGCCCATTTCGGAATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAATTGACGAATG
GTCAATTTCCTGATTGACGTGCCGTGACTCGGCGCGTCTAACCTTGAGGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAA
CTCTAACAGACACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAAGCCTACATACATTTACGACCACCACGACGGGTG
GTCCATAGAGACTTAGGTTTCCTATTGGCTGAGAGCAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGA
TTCCTATCTTAGAATAGTACATTTAGAGGAAATCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTA
GATTAATCTATACTCGGAGGCCCGAGTATAATTAACTGTAATTTAAACTAGGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGG
CCAAAGTAGGCCCATTACAC