Description :
From Genome Similarity Track
Location :
contig_21:22421- 24769
Transcript NameFunction/comments
g4756.t1hypothetical protein
g4757.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
2348 bases(100 bases per row)
TCGGCTAGTCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTG
TCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGTAGTCGCTCCATTGATGGAACGAGTGCGGGTAGCTCTTCATGGTGTCAACCAA
CACGCGGTTGACACTCTCTGTTTGTCCGTCGGTCTGTGGGTGATCCGCAGTCGACATGGACAACTGTGTCCCAAGAAGTGTAAACACTTCTTGCCAGAAT
CTCGCTGTAAAGCGCAGATTCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCAGGTCAACAAACAGACATGCTGTCTGTTTGGCTG
TCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACTAACCAGTCCTCCGCTTGTTGTCTTACGGAAGATCAAAA
ACAAAGTCCATTGAAATGGACTAGCACTCCGACGGAATCGGTAGTGATTGAAACGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGC
AAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGTAAATGTCTTCTCACGGCCAGGATGTCCCGATGTCG
GGGCATCGTGGTACTCGTACGTGATCTTGAGCATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACGGCGCTGTAAAGCAGCAGACCATTGTGTA
CACGATAACGGTGTACACGACGTGTTTGGTCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCATGCGCGTAT
GCGGCCTTCACGTCATCCAGCAAGGACGACGCCAACTGCGTTGGCTTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACA
TTCAACCTTCCAGGTTTGTACTCATGTATTCCGTAAAGAATGACAGCCACCGTGCCATTCTTTGGGATATGTGCGGCGACTTGATCGCCGTACGCAACGA
TGCGTGGTCGGTGTAGACCACGAATGGCCTACTCCCAAGTAGATACACTCGAAATTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACC
GGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGGCCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGA
AATCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGGCTCAGTCAAGCCCTGCTTGACTGCTTTAAAGGCCTG
CTGACAATCAGCAGTCTATTCCCATGCAGCTTCTTTCTTCAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTAC
GTGGCGAGTCCAAGGGACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCT
TCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCATAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTT
GCGGAGATGCTCTGTATGCATCTCCACATCCGACCTCCCATTCACAGCCCGGCTGTGAATGAACACATCATCGAAATAGCTCGGTGCGAAGTCGCGCACC
GAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGTGTTTTTCAGCCCCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGC
TTACCGCCGTGAGAGGGATATCACTCTCACACATGAGGATCTGATAGAACCCGTCTCTCAGATCAAGAGTACTGAAGATAGTACTCGAGGTCATCGAATC
GATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGCTTC
TTGACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCTTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCT
CACGCGGCAGTGGCCACTGCCGCGTGACGCAATACCTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTATCCTGCGGTAACTCCGCAGGAAT
GTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACTTTGTAAAAGGG