Description :
From Genome Similarity Track
Location :
Scaffold_96:224180- 225557
Transcript NameFunction/comments
Aphas_H257_17194Hypothetical protein

Sequence
1377 bases(100 bases per row)
AATTATACAAAATAACTACACACCCCTATTTAGAATAGTTGGGATGTGCCTCCATCATTCTCGCTGTCAGATCCAATTTCCGTTTCGCTGTCACATGCAT
TCCCATTGATAGCCGATTCCGACGCAAGAAACAAAGTCAACCTCGTCTTGCGCTTCTCGCGGTACTTTTGTTGCGCCTTCTTCTTATCCTTGATCTTCTT
CAAACCAATCGTGTTCAAGCGATTCACGTACTGGGTATTCGCATCGCCATCCTCAGCGCGAAGTGGATTGAATCGATTGTGCACATTGGTGATTGCCACG
TAGGTCTGAAAGTGAACGTCATAGTTCTTACGATTCCATCGATAGGCATCGCCACAGATGGCCCAAAGAGTATTCAGTCTACAAAATTAGTTCTCCACGA
CGAAGCGGTCGGTCGCAATGCGGTCGTTAGTGCACTGTTGGTCAAAGGTGAGAAAACCACCCGATGGCTTCTTTGTTGGCAGTACAGCGCGAACTTCATG
CTGAATTCCTTGGTAGCCTTTGTCCGCCAGCACTGCCCATTGCTCGACACGACCGTCAGTGCCCGTCATCTCCATTTCGCTTGGGTGCTTGGTGAGGTTG
GTGCGGTGAAAGTTGAGTTTGTCGTCAAAGATCGCCTTGTCCGAGACACTTCCCTTGTGGTACGAAGTGCAATTGATCCCAAAGCCATTTGGAAGGACTG
ACACCTCAACTTTGTGTCCGTAGAGATGACGCTTGCCGCTGGAGTACAGCTTCTTTTCGGCGTACGAACCGACAGGTACGTTTGTCTTCTGGAAGGTAAC
ATCGGTGGCGTAGCGTGCATATGGGTAGTGCTCGAACCTTGTTCCGTTGGCGGCAAGCTCATGCATCGACCACTTGGATGCCATGCCATGAACATACTTG
CGCAGAAGGTAGGGACGCATGACCTCTATGAAGCTCATGACGCGCTTTTCGAACGTTGCCACAGTTGTGCGAAATGTTTGAGCAACGATATCCCAGGTAC
CGCAGTGCTTGAGTGATGCAAGCATCATGAGCAATAGGCCTCGAGCGGACACTGCACACTTGCGGCCGGATCGCACATTCCAGTGCCTGAAGATGTGCTG
GCGAATGTCTGGCCAGAGAAGGTAAAACTCTGACGGCGAGAAGTTCGTGAGTGTCATTATGCCTTCGGCTCTAGTGTTTAAAGGTAGGCATCGTAGACAG
GCCAGTTGGAATCCTCGTCAATGTCTGGGCCCTCAACGCGTGCGGTAGGGAACCGAGCTCGTTTTGCTTTACGATGTTCTTCTAGGCAGGCCAAGAGAGC
GATTCCTTGGCTCATGCTTCGAGCTTTTAGTGGTGCTTGGCTGGGAATGTTTGCGGGTCTTTCACAGCATATGGCTG