Description :
From Genome Similarity Track
Location :
contig_21:22416- 24763
Transcript NameFunction/comments
g4534.t1hypothetical protein

Sequence
2347 bases(100 bases per row)
TCGGCTAGTCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTG
TCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGTAGTCGCTCCATTGATGGAACGAGTGCGGGTAGCTCTTCATGGTGTCAACCAA
CACGCGGTTGACACTCTCTGTTTGTCCGTCGGTCTGTGGGTGATCCGCAGTCGACATGGACAACTGTGTCCCAAGAAGTGTAAACACTTCTTGCCAGAAT
CTCGCTGTAAAGCGCAGATTCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCAGGTCAACAAACAGACATGCTGTCTGTTTGGCTG
TCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACTAACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAA
ACAAAGTCCATTGAAATGGACTAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGC
AAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAGTAGAAGTCACGCGCGAGAAGCAAGTATGTCTTCTCACGGCCAGGATGTCCCGATGT
CGGGGCATCGTGGTACTCGTACGTGATCTTGAGCATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTG
TACACGATAACGGTGTACACGTGTTTGGTCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCATGTGCGTATG
CGGCCTTCACGACATCCAGCAAGGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACAT
TCAACCTTCCAGGTTTGTACTCATGTATTCCGTAAAGAATGACAGCCACCGTGCCATTCTTTGGGATATGTGCGGCGACTTGATCGCCGTACGCAACGAT
GCGTGGTCGGTGTAGACCACGAATGGCCTACTCCCAAGTAGATACACTCGAAATTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCG
GGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAA
ATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCTCAGTCAAGCCCTGCTTGACTGCTTCAAAGGCCTGCT
GACAATCAGCAGTCCATTCCCATGCAGCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTG
GCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCC
CCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCATAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCG
GAGATGCTCTGTATGCATCTCCACATCCGACCTCCCATTCACAGCCCGGCTGTGAATGAACACATCATCGAAATAGCTCGGTGCGAAGTCGCGCACCGAG
CGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTA
CCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCAAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGAT
GATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTC
ACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCCTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCAC
GCGGCAGTGGCCACTGTCGCGTGACGCAATACTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCG
TCCGGGAGTACATCCTTGTACTCACGCAAGACTTGTAAAAGGGGCTC