Description :
From Genome Similarity Track
Location :
contig_96:22412- 24289
Transcript NameFunction/comments
g12771.t1hypothetical protein
g12772.t1hypothetical protein

Sequence
1877 bases(100 bases per row)
GGAGTAGCGCGCGATTCGCTGTGTATTGGCATTCTGGCGTCTGATTCAGGATTTTAACGGGGACGTATTGCAACGAATACTTCGCGTTTCGAGGCGGTTT
TCGCGGTTGAAGATAGATTGGCGTGCTGCGCACACGTGGAGAGGGTTGGTGTAGCGCTGCGGTGCGTGTGAGCTCTGCTGCAGCCGTCGCAAGAGGCCGC
CGAGGTCGTCCTGAGTGCGCGCGTCCATGAAAGGAAACGAACGCGCCCTTTTCGTCCAAGATTGCGGAACGATCTGATTTGACGGGGCTGGGTAGAATAC
ATAACATAGGGTGATGTACACTATTTAGCGGCTACCAACAGATCGTCGGCGGAATTTCAACCAATGTCAACTCGAATGAGATCACAGTTTTGACCAATAG
TGGCACTTCCACGACGTCGTGGATTCCGGCTCGCTGTGTTTCCAGAAGTTCAAAGGCACAAAACAAAGCGCAAGCCGGAGGAGCTTCGGTGCGTGCTACT
TTCTTCCCCCGTTCGTTCTGCACGTCTGGTTGTGTGTCTAGCCGCTGGTTAACCCCTCGATCTCTAGTGTCTGCGTGTGTGTGTGAAACAGCGGCGTCCA
GATCTTCCCACAAGGAGATTTAACGTCGGATATAGTGGAAAAGGTACGAAAACGAGAAAAAAACACGGCTAAAAGGCGCTCAGAGCGGCGTTTAAACAGC
TTTCTAGCAGCTATACAAGCTGCAGCAGATCGCCCTGCACCTTGCAGCGTGGTCGCGTGGGGCTGTATGAGCTAAATGATGACCTCGTCACTGATTTTAT
GACATTTGTGTCGGTTTTACTCGGTTTTAGCAGTTTCTACAGGGTAAACAAGAACAAGATGGAGGCTATCGGCCAGAAGCTGCTGGATTTCTCGCAGCCC
TTCGATGTGGCGGCGCTGGACCAGGTGGTGCTGTGCATGAACGACCCCAAGAGCCCCACCAGCGGGTGGCCAACCAGATCATGGTGGCGCTGCAGGAGCA
CCAGGACTCGTGGACGCGCGCCTCTGACATCCTGGAGCAGTCCAGTAGCATCCAGACCAAGTTCTTCGGTCTGCAGGTGCGGTGATAATTGTTGCAGTTG
TGACACAATTTGGAGACTCTGACATGCATTTGATGGGCATCAGATCTTGGAGGACGCGATCCGCTACCGCTGGAAGATCTTGCCCAAGGACCAGCGCGAG
GGAATCAAGAGCTACATTGTTGGAAAGCTGCTATCGGTGCGTTGGCGTTGGTTTATTTTTTATGGCGATTGATAGAGGTGCTGATTCGGGTGGGGTGTAT
TGGTTGTGTGCAGCTATCGTCCGATGAGTCGACGCTGCACGGTCAGCGCATGTTTGTGAACAAGATGGACCTCGTGCTGGTGCAGGTGTTGAAGCACGAG
TGGCCGCAGAACTGGCCGTCGTTCATCACGGACATCGTCAACTCAAGCAAAACGTCGGAGATCTTGTGCGAAAACAATATGACGATTCTGAAGCTGCTGA
GTGAGGAGGTGTTCGACTTCTCGAAGGACCAGCTGACGGAACAGAAGACCAAATCGCTCAAGGAAAGCCTCAACCACGAATTCACGCAGATCTTTCAGGT
ACGATTGAGAGCACGGAGAAAGCGCGGTTCGTGTGGCCACAATCGTCTTCGATCTCAACAACGCTAACGTTATGTTTTTATTCTTGCTGTCGATCCTGCT
ACCGTAGCTGTGCGAATTTGTGCTGAACAAGTCGACACACGTTCCGCTGCTTCAGATTACGCTGCAGACACTGCTTCGTTTCCTGAGTTGGATCCCGCTT
GGTTTCATCTTTGAGACGGACCTCATCAAAATCCTTGTCACAAAATTCCTGGCGACGGGCGTGTTCCGCAACGAAAC