Description :
From Genome Similarity Track
Location :
contig_87:22411- 24284
Transcript NameFunction/comments
g12389.t1hypothetical protein

Sequence
1873 bases(100 bases per row)
TGAAACCTAAGACCATCGGTAGCGCGCGGACTCTACTCTGCCTGCAGGCACTCGTGATGCTGATTCTCGGGTAAAGCGTGACAAGGTATTACGACTATCT
CTTCATGCCCGAAGAATGCAATTTTGCAGTATAGTAGCAGAATTCATGCGCTAAAGAAGTCAGAGAAAACCAGTAGTATTGCGAGATTCCGATGGTTAGG
CTGGGAGATTTACTTGGTGTGCCTTTGGGTATTTAAAGGTGGGACATCAGAGACACGATGGTATCAGGATGATGTGGAGCAACCATTTCATGATACGTTC
ACTTGCCATCTATGTTTGTGCGTGGCTTCCACTATTAATATCCATCCAGCTGAATCAATGTTTGTGTAGGAATACCAGTACACGCTACATGTACCTGGTG
AAAGGGTTTTTTACCCATACAAACTAAAGAGAAAGCTGACACTTCAATCGTTCATATAGATGCATGTGTTTCGTACTTGTCGCTCGAATGTCGGTCCCGT
TGAGTTCGGTAGCCAGCTCGCTAACTACCTCCCAGTAAAATGTACTTACTTAGTGCATCTACCAACATGCTGTGATAATCTCATAGACAAAGTGATTTGC
AAAAATGATTAGCAGCGATGCTCTAAATGTAATGAGGACCATAGCCTGAGGCTGCTTCGGTGTCCCGCTGTTCGCCGCGGTATGGAGATAACGTTAAAGC
CTTCTCGCGAGTGAAGTGCACTGTTCGGCGATTGAGTTCACTTCCGTTGGCTCGATGTCCTTTAGGTTTGTTTTTAGCTGACGCACCCGCTTGTTCGCGG
TGAATCCATGAAATTCACGCGATCACCATCGCGCAGGATAATTCATCTGCTCGCTCGTCATTCCGGTTGAGAACGCCGCTCGCAGAATGCTGTGCAAGTT
CTTTAACTTCGTTAAAGTATGGCCTCTGCCGAAAGCACAGCCCAGGATTAGAGATTCTGCACAAACGTGACGCTCCGCGTCTGTTTTGAGTCTTCCCACC
GTGTTTACGGCTTTATGTGAAATATGTGCGCGCGTGAACCAGAGAGAGCAAGCGTTCTGGACTGGACTTCTCATTCCTCAACTCGCCTCGGCATCACCAC
TCAGTTGTACTAAGAGCCGGAAATGGACACGTGCCTTCTCCGCCCGCCTACCCGCAAGGTCCTAAGTGACGACATTATCAGCGGTGCGGCGCAGCGCCCC
CGCGGCTTTCGGTCGTACGCTCATGTCGAGCAGCCCAGTCGACCGACGTATCCCACCGAGCACGTGGCGATGGGGTACCCCCACCCACTCACGTACTACA
CAACACCGGAACACAACTCGGCAGAAGGACCCATGGACAGGAAGAGGAAACGGCAGGAGTCCACCGACTCCACGCTGATGCTCTTGGCAGTTTCCAGTGG
CGCGGCGGAAGGTGGTCCCGGTACAAGTAACAACCAACACGTCAGCACGGAGTGGCTCATGGCGCAGCAGGAACATCAACGGGAGATCCGTCGACTGCGC
CAAATTCGGTACAGGAAGAAGAAAGAGAACTACGCGAACACCCTTGAGGAGAGACCCACCAGCTGCGACAGGAGATTGACAAGCTGGAGCAGCGTCGACG
ATCGGTCTCCTGCTGTCCCAAGCGAGAAGACGCTCTGGAACGTGGCGGTCGAGTACTTCCGCCTGTTTCGCTACGGTCTGCGCGCCTCGGACTTGTCGGA
GCAAGCGGCCAACTCGTCAGAGCCTCAGCCGTGCGCTCAATTGGACTTCCTGCGAGCGGCCATGGCCCCAGACGTCATGTATAACGCTGGACGCGGCATC
GACTCGATCATGACGAACTGGAAGTACTTGTCGCTGTGGTTTCAGGACGTCGAGGTCGAGCTGGACGGCTTAA