Description :
From Genome Similarity Track
Location :
contig_21:22410- 24926
Transcript NameFunction/comments
g3831.t1PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
2516 bases(100 bases per row)
GGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGTAGT
CGCTCCATTGATGGAACGAGTGCGGTAGCTCTTCATGGTGTCAACCAACACGCGGTTGACACTCTGTTTGTCCGTCGGTCTGTGGGTGATCCGCAGTCGA
CATGGACAACTGTGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCAGATCCGATCCGACACGATGTCGAGTGGCATACCATGGT
GTCTAAACACCAGGTCAACAAACAGACATGCTGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAA
GACCACTAACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTAGCACTCCGACGGAGTCGGTAGTGATTGAAGCG
GAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAGTAGAAGTCACG
CGTGAGAAGTAAATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCATCATCCGGCACGACAATGCGAT
CTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGACGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAA
GGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCATGCGCGTATGCGGCCTTCACGTCATCCAGCAAGGACGACGCCAACTGCGTTGGCTTCGGCCTCT
TGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCATGTATTCCGTAAAGAATGACAGCCACCGTGC
CATTCTTTGGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGCTACTCCCAAGTAGATACACTCGAAATTT
GCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCAC
GACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGAT
CGGCGCTCAGTCAAGCCCTGCTTGACTGCTTTAAAGGCCTGCTGACAATCAGCAGTCTATTCCCATGCAGCTCTTTCTTCAAGAGCTGCGACAGCGGGCG
AATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTG
ATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGT
TCGCATAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGACCTCCCATTCACAGCCCGGCTGTGAAT
GAACACATCATCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGTGTTTTTCAGCCCCTGC
GGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCA
GATCAAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGT
TGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTCTTGACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCTTGCGAC
GACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAATACTCGTTCCCGGCACGAGATCAATCTCGTGC
TGAACACCCTTATCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACTTGTAAAAGGGGCTCGCCTTGAGCGAGTC
CCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATC
CTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCG
ACGCTAACGTCGGAGG