Description :
From Genome Similarity Track
Location :
Scaffold_751:2241- 3699
Transcript NameFunction/comments
Phymu_g11832hypothetical protein PHYSODRAFT_246736

Sequence
1458 bases(100 bases per row)
GGATCTTTGACGTGGTGGCGGAATCGAAGTCGATTAGCGAAGGTATTGTTGGATATCCGTCGCTAGTCCAGTCACTGAGTACCTTTCACACCTTTATGTC
TTCGTTCGTTGTGTTGAAAACGTAGGCAAACGCCTTGTTCGACGCCGTCATGTTCCAACTACCCCGATCAAAAATCCATTGAGGGCTCAAATTCGCGTTC
GCGTTGGCATGTCGAGCTCTTCCCCGGCGAAACGAAGGGGAAGAAAGGCCGGTAGATACTCCAGCCTTTTCCTGGCGCGAGCTTGCGATCTTGAGAACTC
GATTGACATACGCCTGCATCTTCAATGGAGCAGACGAAGGGCGCTTTGATCTTGGTgtcgacgatggagctgttggcgTGGCGTCATCTTCGCATTGGAG
TAGTGCTTCCGTCAACAAGATGCTGTCTACCATAGAAGAATTGTCTGGCTCGTTGTCCCTCGCAAGATGCTCAAGGTCGAGAACTGATGATAGCGGATGA
CTTTGCATTTCCATCGCCATGCCGATCACATGCAGGGGGACCGTAATGAACGAAGTCTTGTCGGGAATAGAGAGACCTTGTACTTCCGATGTCTTTGTTC
GTATTAGCCGAAGGAACAGGACGTTTCCGGAAGAAACAGGCAGGTAGCACTTCTGAATAAACTGCAGGTCGGATGCTCGCCCGAATGCATACCACATGAT
GCAAAGGAGAGCCGCGTCTTGGTACTCCTTAACCGATGTGGCGTCGAAGTATAGACCATCGACTAAGGAGCGTAGATCCGCCTTGGTGCATGCAGCTGCC
TTGGTCACTGCCCCGCCCTGCTATCGCTTCATGCAGTGCCGCTCCAGGATCCTCCCCATCTTCAGTAGACGCTGCTCAATGGCGTCGCGATGCCGAGGAT
ACTTTGCCAGTAGccagttcttgacgttgcgATAATAGCTCATGACGGTGTTTTTGTTGTGGACCTCACCACCTCGACCTTGAGAGAAGGCAAGATACAT
CGCGAAccagtccagcagcttgacaAAGGCTGGTCCAACCTCATCACCCTGAAGTGTAGAATACACGAACTCGATCGTGGAGTTTTCGGACGCGAGGAAG
CCCTTGAAAGAGCTGATCGCAGCCGTCTGCGCACGCTTGGTGTTCTCCGGAGCAAGGTCTTGGAGGTTTATGTTTATCAAGTGAGAAGTCTTCAGGTGGT
TGGATGTCTGCCAAATATTTAAAAGtcttgaaatttgtattAACCAAAAAATGtctcgttgccgttgccgacAAAATGCGTCGGCCAAGTGTCGGCAGAC
AGTTAACCTAACCCTAATATTtttcattggataaaatGGTCTCGGGGCTGGATACGATTCGCTAAAGTCGGTATAGCATTTGATTGGCACATATAACCAT
ACATTATCTAAATATATAAATTGTGTGTGTCGGTTGTTTGGCGATATTCATCCCTACC