Description :
From Genome Similarity Track
Location :
Scaffold_1180:2241- 3483
Transcript NameFunction/comments
g16650.t1hypothetical protein

Sequence
1242 bases(100 bases per row)
CGACAACTCGACGTCGTGACAGCGTTCCTGGTACGGGGTCAATGAAGGAGGTTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGGCTTCG
ACTGCCTGGAATTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACGTTCGACGAGTTCATGTGCTCTATCGGCTTCCAAGT
GTCGGCCTTCGATCCGTCCCTCTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCT
GAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGTTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCC
CGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGACATTCTGAAACGCTTCGCCATGGACGAATGCAAGGCTGTGGTGAGTCCGGTGGACAT
GAGCACTCGACTGGTTCCAAGCGACGCGGTGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGCCACGCGCCCG
GACATCGCGTACGCCGTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTCCGCTACCTGCAAGGCA
CCAAGACGCATGGCATCTGCTTCAAGCCGGGCGACAACATCGACTTTCGTGGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCCGACCGCAAGTCCAC
TTCAGGCTACACGTTCATGCTGATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGCGTGTCGCTGTCTACGAGCGAAGCGGAGTACATCGCG
CTCAGTCTGGCTATCCAAGAGGACAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCAACGAGACGGGACCCGAACTCATGATCCGTGAAG
ACAACCAGTCGTGCATCAAGATGACCAAGAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGTGACGAAGTGAAACG
CGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACGAAGGCGCTTGCGGGACCACGCCACACGGAGCTGACGGCGGCT
CTCGGCATTCATGGGACTTCGCATTGATGGGGCGTATTGAGG