Description :
From Genome Similarity Track
Location :
Scaffold_70:22409- 26129
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_70-fgenesh-gene-0.6Histidyl-tRNA synthetase
Pytiw_DAOMBR242034maker-piw_contig_70-fgenesh-gene-0.13Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_70-snap-gene-0.22Chromodomain-helicase-DNA-binding protein

Sequence
3720 bases(100 bases per row)
CATGGAGATGTGTTTATCTACTGTGTAGTGTAGTTCTCACAGAACTTTTGGTTTATTTGTTTGAGTAGGCTGCGGAGAAGTCTGGCTGCTTGCACGCGGT
GATCCTGGGCAGCGAAGAGGTCCAGAGCAAGTTCGTGAAGGTCAAGAACCTCGACAAGCGACAAGAAGAGCAGGTCGCGTTCGCTGACTTGGATGCTTTC
CAATTTGACCAATAGAATACGGAGAACATTGTTGGAAACAGAGGTGGCAGGGTGAGTTTGGAGCTCCGCCAGAGGAGATAGACTGTCTTCGCCACTACCA
TCAACATGATAATAGTAACGCAATATAGAGATACAATGCAATGAAAGACTATTATGTCTTAACACAATACCACTTATCAATGAGCTAGTACGGCGAACCC
GGAAACAACTCGAGGTCCTCGTCGTCACTGAGAACCTGGTTGTCCTCGTCATCATCGTCCTCGTCCCCACCGGCCTCGAGCTCGTGCAGTTTGCGCTTCT
CTTGCTCCAGGAGCTGCTCGAGACGAAGCTGGCGCCGCTGTCGGGCCTCGAGCTTGCACTGCCGGCGTTCCTCGTTCTCGCGTGCCTGCATGTCGATCAT
CCACTGGTACTTGGACGTCGTGAGGCCGAGAAAGTTGGCGACGACCTCGCCAGCAAAGTCGAGGCCATCCCACGTCTTCTCGCCCGACCAGAGCGCCCAC
TGCCACACGGTTTGCGCGTACGAAGCCGCAGACGCACTCTCCTCTGGAGTCGTCAGATCAGGCTTCTCGTCTCTCTTCATGGGCGTCGTGGGGTCATCGC
GGGCGGCCTTCAGCTGGTTGTCGCTGAGCTCCAAGCCGTGTATCATGGTGTCAATGAATATTTTTCACTGGAAACTCGTGTTATGAGCAGCGAAGCGACG
GCGCTTTGCTGAAAATCGTTTCTGTGAAACTCTTGCGAGTCACTTGTTAGTTTGTTGTGAAACTCATGCTGGCCGCTCAATAAGAAGAGCGATGCGGACA
CTTTGCAAGATTTGTTGGTTGACGCATTTGTGTATTTTGTTGTTCAAATATCGGGAGTGCGATGCATTCTCATGAGTGTGGGCATCTCTGTGCTGTTTGG
ACTTGGTTGACCACTTGTACGTGGAGGTGCTGTGCTGGGCTCCGCTCGGCATCTTTATTTCCATCATGGCATTGCAGCATTTTATTTAGAAGGGATGTTG
AAGATGAGTTGAAGAATTCTCAAATTCTTCAAGTCTCAAGTGTCGATCAAGCCGACCCAACATGCGACTCACCACGGGAATCACTCGCCCAAACAACGAA
TATCGGAGGTGGAGACTTCCGGAGCGTACGTGGTGTCACGACCGCACCTCCTCTTAGGACGAGTTGCTGATGGCGTCACGGAATGGATTTTAGGCGCAAA
AAAACTCAATAAAAAATAACAACGCGTGAGCAAATCTCCAAGGTGCTCAACGCAAGAAGCCTCTGAGACTTGATACTGAAAGGTCGCGAGAATTTGCTTT
GGACTCTCCATGGTTACGCTTTTGTATCTTTTCGGTTACTCTGGTTACCATTCCTTAAAAAACGCGGGAAAGCAAAAAGTGTCAACTCATTGAATTGCAC
CATACAAACATCAAGGTTAGCGCAATTCACTAGCTCCAATTCAAATCGAGTAAAGTGGTTAAAGGCTGTCATATATATAGTGGTTTTTGAGGTCTTGGCG
AGCAAAAAGCGGGTCTTTTTAGGCGGGCATTTCATCCAAATTGCAAGTGGCGACGAGCGCGGAAGAGCAGCACCAACCGGCATTCATTCGCCATGGACCC
CGCGCCACAAGGTGCGTACGCATCATCACATTACGTGTGACTCTGCATTTGCATGTCCTGATGCGTTCAAAGGCTTCTTTGTGTGTATTTTGGATGCGTG
ACCGGCCTGCGATTGGTTCGCAGTCCATCAGAAGCGCATGCGTCCGCTTGGCATGCGTTGAGTGGAAATGTGTGGTGCCTGTGGATTAATATAGTGCGCG
GGAAGCGATGGATTACCTTCGCTAACGCTAACTGTTGTTTGACTGCTGCTTTTTGGGTGTTTGTAGCGCCGATAGTGTCAGCTAAGCCGCTCGCGCTAGC
TCCAATGATTACTGCCACGCCGCAGACGCAGCAAGTGGAAACTGTTCCGGAGCCACAGCAGCAGCACCAAGACGTAGTTGTAGCTGCGCAGCTTCTTCCA
CTCGCAACAGTCCCACCTCAGCAGTCACTCGCAGCCCCATCTCAACAGCCACTCGAAGATCCACCTCAACAGCCAGACGCAGTTCCAACACAGCAGCTCG
TCGCGACCCCAGTGCAGCAGCCAGTCGCAAGTGTGGAACAGCAGCAGCTCGTAATTTTAGAGCAGCAACAGGTACACATCTGCTACGAAAGCCAGGCCGC
TTGTGGTTGTCTATTGGCTAATGAATTTGGTATTTTGTGATCCTTGTAGGAAACAACGTCCGGTGCCGCCAAGGATGCCGATAGCGATGGCCGTCGCAAA
CGCCGCAAGAGTCTCAAGAACATCAAATATGTCGAGGACGATGGCTCCGACGATGAAGAAATCGTTATTGCGACTGAGAAGAAGCGGAAAGCGCGCCAAT
TGGACTACCAACTGCGAACGGTGCGTCGATTATAATGACAAAAGGACACATGCTTGTATTATTATTTCCGAGTCGCTGACATTTTATTCCTCGCCTCGTG
CATGAACAGGATTCGACATACCCACAGCTGGATCTGATCGTCGGCCGTCGCATTAACAAGCGCAGTGGGCTCGTCGAGTACCTCTGTAAGTTCGTCGGCC
GCTCGTACCTGCACCTATGGTGGCTCACGTTCAGTGAGCTGGAGCTCTTCATCCCCGAGGGCTACCAGAAGCAACATCGCGTGCAGCTCTTCGACCGCAA
GTTGCGTCGCGAAGGGTACCAAGACATTGATGACGTGGACGACTTAGAGGCGAACAAAGTGACGGTCGAGAAAATCCTGAGCCATCGTGTCGACCCGCGA
GACAAACTCGACGACCAAATCGAAAAGCGCCGACAGGAGCTGCCGTTTGCGCCAAGGTACCCGAGCGTGACCGACTACTTCCTGCTCAGCAATGCCGACG
TGCTCCCCGAGCGAATGACAGGGATCATTAAGAAGCTTTTGAATGAGAATGGCGGCGAGATTTTCGAGCACCCGGTCGACACAGAGTACGTTCTACTTGC
TGTACTGTATGCTGGCGGTTTTGAAGTGGTCTCGCTAACGAATTTCATTTTGCTTTATCGGAACAGGGAAATTCCAGATTACCTCAACTACATTCTGAAC
CCGATGGACTTTGGCTCGATCGCGGCGAGACTTTCGAGAGAAAACTACTACGTCGGCCCAGCGGCTGCGTCGCTATTCATCTCGGATGTGCGGCTCGTGT
TCTCGAACTGCAAAGAGTTCAATGCGGCTGGGTCGGACATCTGGTTGATTACTGACGATCTCTCGAAAACCTTTGAGAAGTGGATCTACGAGTGGATTTT
GGCGCCCTCTGCGTGGCTGAAATTGCAGCCAACCGCTGACAAGGAGATAGACAAGAAACTCACGGAAGAGTTCCGTGAAGAAGGCGAAGACAGCTACGAC
CTGTGGTCTCCATGGGAACCTGGGTGCACGATTTGCCGGAAGAACGACAACAGCGAACAGCTTCTTCTCTGCGATCGCTGTGATGGCGAGATTCACATGT
ACTGCTCCACGCCAGAGATG